ID QT-TAX-ZM-011; SV 0; linear; genomic DNA; STS; PLN; 70 BP. XX AC ; XX DT 03-JUL-2008 DT 27-JAN-2015 XX DE Quantitative PCR method for detection of maize alcohol dehydrogenase 1 XX KW taxon_specific, validated_in_combination. XX OS Zea mays XX RN [1] RP 1-70 RA Paoletti C., Mazzara M., Puumalaainen J., Rasulo D., Van Den Eede G.; RT "Validation of an Event-Specific Method for the Quantitation of Maize Line GA21 Using Real-Time PCR Validation Report and Protocol"; RL Online Publication (2005). RX CRL=GA21_Validation_Report+Protocol[1].pdf XX RN [2] RP 1-70 RA Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2005). RX BSHOP=LBNA21830 XX RN [3] RP 1-70 RA Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2005). RX BSHOP=LBNA21825 XX RN [4] RP 1-70 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-ZM-007; DR GMOMETHODS; QT-EVE-ZM-009; DR GMOMETHODS; QT-EVE-ZM-008; XX CC Based on scientific evidence, the adh1 (70 bp) endogenous reference gene assay targets a CC region in the maize genome that shows a sequence polymorphism, which may affect the CC efficiency of amplification (Broothaerts et al., 2008). Users of this event-specific CC quantification method should, therefore, replace the maize adh1 (70 bp) gene assay with CC the hmg gene assay (or any other suitable maize reference gene assay). Bridging CC experiments by the EURL-GMFF [EU-RL GMFF validation report (13 November 2013): Report on CC the verification of the performance of 1507, 59122, MON 810 and NK603 event-specific CC PCR-based methods applied to DNA extracted from stack maize 1507 x 59122 x MON 810 x NK603 CC (http://biotech-staging.jrc.it/StatusOfDossiers.aspx)] have demonstrated that this CC event-specific quantification method performs adequately in combination with hmg as CC reference gene target. XX FH Key Location/Qualifiers FH FT STS 1..70 FT /standard_name="PCR 70bp amplicon" FT /note="taxon-specific RT-PCR for maize" FT /target="alcohol dehydrogenase1 (adh1) gene" FT primer_bind 1..20 FT /standard_name="Primer reverse: Adh1 primer R" FT /note="CCTTCTTGGCGGCTTATCTG" FT /target="adh1" FT primer_bind 22..47 FT /standard_name="RT-PCR probe: Adh1 probe" FT /note="FAM-CTTAGGGGCAGACTCCCGTGTTCCCT-TAMRA" FT primer_bind complement(53..70) FT /standard_name="Primer forward: Adh1 primer F" FT /note="CCAGCCTCATGGCCAAAG" FT /target="adh1" XX SQ Sequence 70 BP; 6 A; 19 C; 19 G; 20 T; 6 other; ccttcttggc ggcttatctg ncttaggggc agactcccgt gttccctnnn nnctttggcc 60 atgaggctgg 70 //