ID QL-CON-00-012; SV 1; linear; genomic DNA; STD; SYN; 220 BP. XX AC CUH-CP551-8, CUH-CP631-7; XX DT 05-FEB-2014 DT 06-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chimeric CMV/PRSV coat protein (ISO/FDIS 21569:2005/Amd.1:2013). XX KW construct_specific. XX OS Carica papaya (papaya) XX RN [1] RP 1-220 RT "Foodstuffs--Methods of analysis for the detection of genetically modified organisms and derived products -- Qualitative nucleic acid based methods Amendment 1"; RL ISO 21569/Amd.1:1-87 (2013). RX ISO=56164 XX RN [2] RP 1-220 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2013). RX PCR=QL-CON-00-012.pdf XX FH Key Location/Qualifiers FH FT STS 1..220 FT /standard_name="PCR 220 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chimeric cucumber mosaic virus coat protein/papaya ring spot virus coat protein (CMV/PRSV CP)" FT primer_bind 1..21 FT /standard_name="Primer forward: 35S-F" FT /note="GACGTAAGGGATGACGCACAA" FT /target="CaMV P-35S" FT primer_bind 23..48 FT /standard_name="RT-PCR probe: 35S -T" FT /note="FAM-CCCACTATCCTTCGCAAGACCCTTCC-TAMRA" FT primer_bind complement(200..220) FT /standard_name="Primer reverse: sunup-ar1" FT /note="TCATTCTTGGACTGACGACGT" FT /target="CMV/PRSV CP" XX SQ Sequence 220 BP; 58 A; 48 C; 52 G; 62 T; 0 other; gacgtaaggg atgacgcaca ancccactat ccttcgcaag acccttccnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180 nnnnnnnnnn nnnnnnnnna cgtcgtcagt ccaagaatga 220 //