An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-ZM-005; SV 0; linear; genomic DNA; STS; PLN; 79 BP.
XX
AC   ;
XX
DT   29-MAY-2009
DT   08-MAY-2018
XX
DE   Quantitative PCR method for detection of maize high-mobility-group gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Zea mays (maize)
XX
RN   [1]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize DP-004114-3 Using Real-time PCR - Validation Report";
RL   Online Publication (2018).
RX   EURL_GMFF=EURL-VL-02-14-VP.pdf
RX   EURL_GMFF=EURL-VL-02-14-VR.pdf
XX
RN   [2]
RP   1-79
RT   "See Cross-references below";
RL   Online Publication (2018).
XX
DR   GMOMETHODS; QT-EVE-ZM-026;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..79
FT                   /standard_name="PCR 79 bp amplicon"
FT                   /note="taxon-specific RT-PCR for maize"
FT                   /target="high-mobility-group (hmg) gene"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: ZM1-F"
FT                   /note="TTGGACTAGAAATCTCGTGCTGA"
FT                   /target="hmg"
FT   primer_bind     complement(41..56)
FT                   /standard_name="RT-PCR probe: PHN149436"
FT                   /note="FAM-CAATCCACACAAACGC-MGB"
FT   primer_bind     complement(58..79)
FT                   /standard_name="Primer reverse: ZM1-R"
FT                   /note="GCTACATAGGGAGCCTTGTCCT"
FT                   /target="hmg"
XX
SQ   Sequence 79 BP; 16 A; 13 C; 22 G; 28 T; 0 other;
     ttggactaga aatctcgtgc tgannnnnnn nnnnnnnnnn gcgtttgtgt ggattgnagg        60
     acaaggctcc ctatgtagc                                                     79
//