Only one hit for query 'ac%3AMON-87419-8'
ID QT-EVE-ZM-029; SV 0; linear; genomic DNA; STD; PLN; 97 BP. XX AC MON-87419-8; XX DT 13-SEP-2019 DT 13-SEP-2019 XX DE Quantitative PCR method for detection of maize event MON87419 (EURL GMFF, 2019). XX KW event_specific. XX OS Zea mays (maize) - event MON87419 (MON-87419-8). XX RN [1] RP 1-97 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR"; RL Online Publication (2019). RX EURL_GMFF=EURL-VL-02_17_VR_MON87419.pdf RX EURL_GMFF=EURL-VL-02_17_VM_MON87419.pdf XX RN [2] RP 1-97 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2019). RX PCR=QT-EVE-ZM-029.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..97 FT /standard_name="PCR 97 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="5' integration border region FT (IBR) between the insert of maize event MON87419 and the maize host genome"; FT primer_bind 1..19 FT /standard_name="Primer forward: 87419 QF" FT /note="CGGTCGCTGCCAGGTATTG" FT /target="5'-host genome" FT primer_bind 21..46 FT /standard_name="RT-PCR probe: 87419 QP" FT /note="FAM-TGTGCGCCAGTCAGCATCATCACACC-TAMRA" FT primer_bind complement(75..97) FT /standard_name="Primer reverse: 87419 QR" FT /note="CAGACCTCAATTGCGAGCTTTCT" FT /target="insert" XX SQ Sequence 97 BP; 27 A; 22 C; 25 G; 23 T; 0 other; cggtcgctgc caggtattgn tgtgcgccag tcagcatcat cacaccnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnagaaag ctcgcaattg aggtctg 97 //