An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-87411-9'
ID   QT-EVE-ZM-024; SV 0; linear; genomic DNA; STS; SYN; 109 BP.
XX
AC   MON-87411-9;
XX
DT   20-FEB-2015
DT   11-JUL-2016
XX
DE   Quantitative PCR method for detection of maize event MON87411(EURL GMFF, 2016).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON87411 (MON-87411-9)
XX
RN   [1]
RP   1-109
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-01-15-VR.pdf
RX   EURL_GMFF=EURL-VL-01-15-VP.pdf
XX
RN   [2]
RP   1-109
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-ZM-024.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..109
FT                   /standard_name="PCR 109 bp amplicon"
FT                   /note="Event-specific RT-PCR;
FT                   /target="3' integration border region (IBR) between the insert of maize event MON87411 and the maize host genome";
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: 87411 QF"
FT                   /note="CTCTGTAACAGAAAACACCATCTAGAG"
FT                   /target="insert"
FT   primer_bind     31..60
FT                   /standard_name="RT-PCR probe: 87411 QP"
FT                   /note="FAM-CCGCGTTTAAACTATCAGTGTTTAGAGAAT-TAMRA"
FT   primer_bind     complement(82..109)
FT                   /standard_name="Primer reverse: 87411 QR"
FT                   /note="ACAAAAGTGAACTAGTTCTAGGGTAGAT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 109 BP; 35 A; 25 C; 17 G; 32 T; 0 other;
     ctctgtaaca gaaaacacca tctagagnnn ccgcgtttaa actatcagtg tttagagaat        60
     nnnnnnnnnn nnnnnnnnnn natctaccct agaactagtt cacttttgt                   109
//