European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:MON-87411-9'
ID   QT-EVE-ZM-024; SV 0; linear; genomic DNA; STS; SYN; 109 BP.
XX
AC   MON-87411-9;
XX
DT   20-FEB-2015
DT   11-JUL-2016
XX
DE   Quantitative PCR method for detection of maize event MON87411(EURL GMFF, 2016).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON87411 (MON-87411-9)
XX
RN   [1]
RP   1-109
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-01-15-VR.pdf
RX   EURL_GMFF=EURL-VL-01-15-VP.pdf
XX
RN   [2]
RP   1-109
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-ZM-024.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..109
FT                   /standard_name="PCR 109 bp amplicon"
FT                   /note="Event-specific RT-PCR;
FT                   /target="3' integration border region (IBR) between the insert of maize event MON87411 and the maize host genome";
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: 87411 QF"
FT                   /note="CTCTGTAACAGAAAACACCATCTAGAG"
FT                   /target="insert"
FT   primer_bind     31..60
FT                   /standard_name="RT-PCR probe: 87411 QP"
FT                   /note="FAM-CCGCGTTTAAACTATCAGTGTTTAGAGAAT-TAMRA"
FT   primer_bind     complement(82..109)
FT                   /standard_name="Primer reverse: 87411 QR"
FT                   /note="ACAAAAGTGAACTAGTTCTAGGGTAGAT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 109 BP; 35 A; 25 C; 17 G; 32 T; 0 other;
     ctctgtaaca gaaaacacca tctagagnnn ccgcgtttaa actatcagtg tttagagaat        60
     nnnnnnnnnn nnnnnnnnnn natctaccct agaactagtt cacttttgt                   109
//