European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:REN-00038-3'
Entry information
Entry name QT-EVE-ZM-017;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier REN-00038-3
Description
Description Quantitative PCR method for detection of maize event LY038 (Charles Delobel et al., 2008).
Keywords event_specific.
From Zea mays (maize) - event LY038 (REN-00038-3)
References
1 Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/43570
Reference Position 1-111
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-017.pdf
Reference Position 1-111
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..111 standard_namePCR 111 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event LYO38 and the maize host genome
primer_b 1..21 standard_namePrimer forward: LY038 AF
noteTGGGTTCAGTCTGCGAATGTT
target5'-host genome
primer_b 61..84 standard_nameRT-PCR probe: LY038 AP
noteFAM-CGAGCGGAGTTTATGGGTCGACGG-TAMRA
primer_b complement(87..111) standard_namePrimer reverse: LY038 AR
noteAGGAATTCGATATCAAGCTTATCGA
targetinsert
Sequence information
Length: 111 BP, A Count: 14, C Count: 12, T Count: 22, G Count: 22
tgggttcagt ctgcgaatgt tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
cgagcggagt ttatgggtcg acggnntcga taagcttgat atcgaattcc t                111