An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-IR604-5'
ID   QT-EVE-ZM-013; SV 0; linear; genomic DNA; STS; SYN; 76 BP.
XX
AC   SYN-IR604-5;
XX
DT   29-MAY-2006
DT   20-OCT-2010
XX
DE   Quantitative PCR method for detection of maize event MIR604
DE   (Mazzara et al., 2007).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MIR604 (SYN-IR604-5)
XX
RN   [1]
RP   1-76
RA   Mazzara M.,  Munaro B., Foti N., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation Report and Protocol - Maize Seeds Sampling and DNA Extraction";
RL   Online Publication (2007).
RX   DOI=10.2788/30596
XX
RN   [2]
RP   1-76
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-013.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..76
FT                   /standard_name="PCR 76 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event MIR 604 and the maize host genome"
FT   primer_bind     1..18
FT                   /standard_name="Primer forward: MIR604 primer F"
FT                   /note="GCGCACGCAATTCAACAG"
FT                   /target="5'-host genome"
FT   primer_bind     20..45
FT                   /standard_name="RT-PCR probe: MIR604 Probe"
FT                   /note="FAM-AGGCGGGAAACGACAATCTGATCATG-TAMRA"
FT   primer_bind     complement(51..76)
FT                   /standard_name="Primer reverse: MIR604 primer R"
FT                   /note="GGTCATAACGTGACTCCCTTAATTCT"
FT                   /target="insert"
XX
SQ   Sequence 76 BP; 24 A; 15 C; 19 G; 12 T; 6 other;
     gcgcacgcaa ttcaacagna ggcgggaaac gacaatctga tcatgnnnnn agaattaagg        60
     gagtcacgtt atgacc                                                        76
//