Only one hit for query 'ac:MON-00863-5'
Entry information |
Entry name | QT-EVE-ZM-009; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | MON-00863-5 |
Description |
Description | Quantitative PCR method for detection of maize event MON863 (Mazzara et al., 2005). |
Keywords | event_specific. |
From | Zea mays (maize) - event MON863 (MON-00863-5) |
References |
1 | Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2005) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-TAX-ZM-011; |
Features |
Key | Location | Qualifier | Value | STS | 1..84 | standard_name | PCR 84 bp amplicon | note | event-specific RT-PCR | target | 5' integration border region (IBR) between the insert of maize event MON 863 and the maize host genome | primer_b | 1..23 | standard_name | Primer forward: MON863 primer F | note | TGTTACGGCCTAAATGCTGAACT | target | 5'-host genome | primer_b | complement(26..53) | standard_name | RT-PCR probe: MON863 Probe | note | FAM-TGAACACCCATCCGAACAAGTAGGGTCA-TAMRA | primer_b | complement(63..84) | standard_name | Primer reverse: MON863 primer R | note | GTAGGATCGGAAAGCTTGGTAC | target | insert |
|
Sequence information |
Length: 84 BP, A Count: 15, C Count: 19, T Count: 23, G Count: 16 |
tgttacggcc taaatgctga actnntgacc ctacttgttc ggatgggtgt tcannnnnnn 60
nngtaccaag ctttccgatc ctac 84
|