Only one hit for query 'ac:MON-00603-6'
Entry information |
Entry name | QT-EVE-ZM-008; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | MON-00603-6 |
Description |
Description | Quantitative PCR method for detection of maize event NK603 (Mazzara et al., 2005). |
Keywords | event_specific. |
From | Zea mays (maize) - Event NK603 (MON-00603-6) |
References |
1 | Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2005) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-TAX-ZM-011; |
Features |
Key | Location | Qualifier | Value | STS | 1..108 | standard_name | 108 bp amplicon | note | event-specific RT-PCR | target | 3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome | primer_b | 1..27 | standard_name | Primer forward: NK603-F | note | ATGAATGACCTCGAGTAAGCTTGTTAA | target | insert | primer_b | 54..79 | standard_name | RT-PCR probe: NK603-PR | note | FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA | primer_b | complement(81..108) | standard_name | Primer reverse: NK603-R | note | AAGAGATAACAGGATCCACTCAAACACT | target | 3'-host genome |
|
Sequence information |
Length: 108 BP, A Count: 19, C Count: 19, T Count: 26, G Count: 17 |
atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc 60
acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt 108
|