Only one hit for query 'ac:MON-00603-6'
| Entry information |
|---|
| Entry name | QT-EVE-ZM-008; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
| GMO Unique Identifier | MON-00603-6 |
| Description |
|---|
| Description | Quantitative PCR method for detection of maize event NK603 (Mazzara et al., 2005). |
| Keywords | event_specific. |
| From | Zea mays (maize) - Event NK603 (MON-00603-6) |
| References |
|---|
| 1 | Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2005)
|
| 2 | "PCR reactions set up and amplification conditions" Online Publication (2010)
|
| Cross-references |
|---|
| GMOMETHODS | QT-TAX-ZM-011; |
| Features |
|---|
| Key | Location | Qualifier | Value |
|---|
| STS | 1..108 | standard_name | 108 bp amplicon | | note | event-specific RT-PCR | | target | 3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome | | primer_b | 1..27 | standard_name | Primer forward: NK603-F | | note | ATGAATGACCTCGAGTAAGCTTGTTAA | | target | insert | | primer_b | 54..79 | standard_name | RT-PCR probe: NK603-PR | | note | FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA | | primer_b | complement(81..108) | standard_name | Primer reverse: NK603-R | | note | AAGAGATAACAGGATCCACTCAAACACT | | target | 3'-host genome |
|
| Sequence information |
|---|
| Length: 108 BP, A Count: 19, C Count: 19, T Count: 26, G Count: 17 |
atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc 60
acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt 108
|
