Only one hit for query 'ac:MON-87460-4'
ID QT-EVE-ZM-005; SV 0; linear; genomic DNA; STS; SYN; 82 BP. XX AC MON-87460-4; XX DT 16-APR-2009 DT 07-FEB-2012 XX DE Quantitative PCR method for detection of maize event MON87460 (Savini et al., 2011) XX KW event_specific. XX OS Zea mays (maize) - event MON87460 (MON-87460-4) XX RN [1] RP 1-82 RA Savini C., Mazzara M., Pinski G., Van den Eede G.; RT "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR -Validation Report and Validated Method"; RL Online Publication (2012). RX DOI=10.2788/45380 XX RN [2] RP 1-82 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2012). RX PCR=QT-EVE-ZM-005.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..82 FT /standard_name="PCR 82 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5'integration border region (IBR) between the insert of maize event MON87460 and the maize host genome"; FT primer_bind 1..22 FT /standard_name="Primer forward: MON 87460 primer 1" FT /note="CACGTTGAAGGAAAATGGATTG" FT /target="5'-host genome" FT primer_bind 24..61 FT /standard_name="RT-PCR probe: MON 87460 Probe" FT /note="FAM-AGGGAGTATGTAGATAAATTTTCAAAGCGTTAGACGGC-TAMRA" FT primer_bind complement(63..82) FT /standard_name="Primer reverse: MON 87460 Primer 2" FT /note="TCGCGATCCTCCTCAAAGAC" FT /target="insert" XX SQ Sequence 82 BP; 25 A; 9 C; 27 G; 21 T; 0 other; cacgttgaag gaaaatggat tgnagggagt atgtagataa attttcaaag cgttagacgg 60 cngtctttga ggaggatcgc ga 82 //