European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.

Perform your search by inserting a key word or by selecting a GMO unique identifier.

Only one hit for query 'ac:MON-87460-4'
ID   QT-EVE-ZM-005; SV 0; linear; genomic DNA; STS; SYN; 82 BP.
AC   MON-87460-4;
DT   16-APR-2009
DT   07-FEB-2012
DE   Quantitative PCR method for detection of maize event MON87460 (Savini et al., 2011)
KW   event_specific.
OS   Zea mays (maize) - event MON87460 (MON-87460-4)
RN   [1]
RP   1-82
RA   Savini C., Mazzara M., Pinski G., Van den Eede G.;
RT   "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR -Validation Report and Validated Method";
RL   Online Publication (2012).
RX   DOI=10.2788/45380
RN   [2]
RP   1-82
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-ZM-005.pdf
FH   Key             Location/Qualifiers
FT   STS             1..82
FT                   /standard_name="PCR 82 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of maize event MON87460 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MON 87460 primer 1"
FT                   /note="CACGTTGAAGGAAAATGGATTG"
FT                   /target="5'-host genome"
FT   primer_bind     24..61
FT                   /standard_name="RT-PCR probe: MON 87460 Probe"
FT                   /note="FAM-
FT   primer_bind     complement(63..82)
FT                   /standard_name="Primer reverse: MON 87460 Primer 2"
FT                   /note="TCGCGATCCTCCTCAAAGAC"
FT                   /target="insert"
SQ   Sequence 82 BP; 25 A; 9 C; 27 G; 21 T; 0 other;
     cacgttgaag gaaaatggat tgnagggagt atgtagataa attttcaaag cgttagacgg        60
     cngtctttga ggaggatcgc ga                                                 82