European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


ID   QT-EVE-ZM-004; SV 0; linear; genomic DNA; STS; SYN; 98 BP.
XX
AC   DAS-40278-9;
XX
DT   15-NOV-2010
DT   23-AUG-2013
XX
DE   Quantitative PCR method for detection of maize event DAS-40278-9 (Savini et al., 2012).
XX
KW   event_specific. 
XX
OS   Zea mays (maize) - event DAS-40278-9 (DAS-40278-9)
XX
RN   [1]
RP   1-98
RA   Savini C., et al.;
RT   "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7";
RL   Online Publication (2012).
RX   DOI=10.2788/64013 
XX
RN   [2]
RP   1-98
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-ZM-004.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..98
FT                   /standard_name="PCR 98 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of maize event DAS-40278-9 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: DAS-40278-9_5'-f1"
FT                   /note="CACGAACCATTGAGTTACAATC"
FT                   /target="5'-host genome"
FT   primer_bind     complement(43..67)
FT                   /standard_name="RT-PCR probe: DAS-40278-9_5'-S2"
FT                   /note="FAM-CGTAGCTAACCTTCATTGTATTCCG-TAMRA"
FT   primer_bind     complement(76..98)
FT                   /standard_name="Primer reverse: DAS-40278-9_5'-r3"
FT                   /note="TGGTTCATTGTATTCTGGCTTTG"
FT                   /target="insert"
XX
SQ   Sequence 98 BP; 39 A; 23 C; 18 G; 18 T; 0 other;
     cacgaaccat tgagttacaa tcnnnnnnnn nnnnnnnnnn nncggaatac aatgaaggtt        60
     agctacgnnn nnnnncaaag ccagaataca atgaacca                                98
//