European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:SYN-05307-1'
Entry information
Entry name QT-EVE-ZM-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-05307-1
Description
Description Quantitative PCR method for detection of maize event 5307(EURL GMFF, 2014).
Keywords event_specific.
From Zea mays (maize) - event 5307 (SYN-05307-1)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validation Report and Validated Method" Online Publication (2014)
EURL_GMFF EURL-VL-07-11VR_Maize 5307 final report.pdf
EURL_GMFF 2014-12-05_VP_EURL-VL-07-11FINAL.pdf
Reference Position 1-107
2 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QT-EVE-ZM-002.pdf
Reference Position 1-107
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..107 standard_namePCR 107 bp amplicon
noteEvent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event 5307 and the maize host genome
primer_b 1..21 standard_namePrimer forward: 5307i3' forward primer
noteCATGGCCGTATCCGCAATGTG
targetinsert
primer_b 54..82 standard_nameRT-PCR probe: 5307i3'-s2 probe
noteFAM-ACCACAATATACCCTCTTCCCTGGGCCAG-TAMRA
primer_b complement(90..107) standard_namePrimer reverse: 5307i3' reverse primer
noteTGCACCCTTTGCCAGTGG
target3'-host genome
Sequence information
Length: 107 BP, A Count: 24, C Count: 29, T Count: 29, G Count: 25
catggccgta tccgcaatgt gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaccacaa        60
tataccctct tccctgggcc agnnnnnnnc cactggcaaa gggtgca                     107