European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:ACS-OS002-5'
Entry information
Entry name QT-EVE-OS-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-OS002-5
Description
Description Quantitative PCR method for detection of rice event LLRICE62 (Mazzara et al., 2006).
Keywords event_specific.
From Oryza sativa (rice) - event LLRICE62 (ACS-OS002-5)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Event-specific Method for the Quantitation of Rice Line LLRICE62 Using Real-time PCR -Validation Report and Protocol - Sampling and DNA Extraction of Rice" Online Publication (2006)
DOI 10.2788/31940
Reference Position 1-88
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-OS-002.pdf
Reference Position 1-88
Cross-references
GMOMETHODS QT-TAX-OS-017;
Features
Key Location Qualifier Value
STS 1..88 standard_namePCR 88 bp_amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of rice event LLRICE62 and the rice host genome
primer_b 1..22 standard_namePrimer forward: MDB616
noteAGCTGGCGTAATAGCGAAGAGG
targetinsert
primer_b 25..54 standard_nameRT-PCR probe: TM019
noteFAM-CGCACCGATTATTTATACTTTTAGTCCACCT-TAMRA
primer_b complement(68..88) standard_namePrimer reverse: MDB694
noteTGCTAACGGGTGCATCGTCTA
target3'-host genome
Sequence information
Length: 88 BP, A Count: 22, C Count: 20, T Count: 26, G Count: 20
agctggcgta atagcgaaga ggcccgcacc gattatttat acttttagtc cacctggttt        60
ttattgatag acgatgcacc cgttagca                                           88