European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:BCS-GM151-6 '
Entry information
Entry name QT-EVE-GM-018;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BCS-GM151-6
Description
Description Quantitative PCR method for detection of soybean event GMB151 (EURL GMFF, 2020).
Keywords event_specific.
From Glycine max (soybean) - event GMB151 (BCS-GM151-6)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean GMB151 Using Real-time PCR - Validation Report"; Online Publication (2020)
EURL_GMFF EURL-VL-01-18-VR.pdf
EURL_GMFF EURL-VL-01-18-VM.pdf
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2020)
PCR QT-EVE-GM-018.pdf
Reference Position 1-84
Cross-references
GMOMETHODS QT-TAX-GM-003;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event GMB151 and the soybean host genome
primer_b 1..25 standard_namePrimer forward: PRIM1040
noteTCAAATCAACATGGGTGACTAGAAA
target5'-host genome
primer_b 30..52 standard_nameRT-PCR probe: TM1789
noteFAM-CAGTACTGGGCCCTTGTGGCGCT-BHQ1
primer_b complement(55..84) standard_namePrimer reverse: PRIM1041
noteCATTGTGCTGAATAGGTTTATAGCTATGAT
targetinsert
Sequence information
Length: 84 BP, A Count: 28, C Count: 19, T Count: 21, G Count: 16
tcaaatcaac atgggtgact agaaannnnc agtactgggc ccttgtggcg ctnnatcata        60
gctataaacc tattcagcac aatg                                               84