Only one hit for query 'ac:BCS-GM151-6 '
Entry information |
Entry name | QT-EVE-GM-018; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | BCS-GM151-6 |
Description |
Description | Quantitative PCR method for detection of soybean event GMB151 (EURL GMFF, 2020). |
Keywords | event_specific. |
From | Glycine max (soybean) - event GMB151 (BCS-GM151-6) |
References |
1 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean GMB151 Using Real-time PCR - Validation Report"; Online Publication (2020) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2020) |
Cross-references |
GMOMETHODS | QT-TAX-GM-003; |
Features |
Key | Location | Qualifier | Value | STS | 1..84 | standard_name | PCR 84 bp amplicon | note | Event-specific RT-PCR | target | 5' integration border region (IBR) between the insert of soybean event GMB151 and the soybean host genome | primer_b | 1..25 | standard_name | Primer forward: PRIM1040 | note | TCAAATCAACATGGGTGACTAGAAA | target | 5'-host genome | primer_b | 30..52 | standard_name | RT-PCR probe: TM1789 | note | FAM-CAGTACTGGGCCCTTGTGGCGCT-BHQ1 | primer_b | complement(55..84) | standard_name | Primer reverse: PRIM1041 | note | CATTGTGCTGAATAGGTTTATAGCTATGAT | target | insert |
|
Sequence information |
Length: 84 BP, A Count: 28, C Count: 19, T Count: 21, G Count: 16 |
tcaaatcaac atgggtgact agaaannnnc agtactgggc ccttgtggcg ctnnatcata 60
gctataaacc tattcagcac aatg 84
|