Only one hit for query 'ac:BCS-GM151-6 '
| Entry information |
|---|
| Entry name | QT-EVE-GM-018; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
| GMO Unique Identifier | BCS-GM151-6 |
| Description |
|---|
| Description | Quantitative PCR method for detection of soybean event GMB151 (EURL GMFF, 2020). |
| Keywords | event_specific. |
| From | Glycine max (soybean) - event GMB151 (BCS-GM151-6) |
| References |
|---|
| 1 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean GMB151 Using Real-time PCR - Validation Report"; Online Publication (2020)
|
| 2 | "PCR reactions set up and amplification conditions" Online Publication (2020)
|
| Cross-references |
|---|
| GMOMETHODS | QT-TAX-GM-003; |
| Features |
|---|
| Key | Location | Qualifier | Value |
|---|
| STS | 1..84 | standard_name | PCR 84 bp amplicon | | note | Event-specific RT-PCR | | target | 5' integration border region (IBR) between the insert of soybean event GMB151 and the soybean host genome | | primer_b | 1..25 | standard_name | Primer forward: PRIM1040 | | note | TCAAATCAACATGGGTGACTAGAAA | | target | 5'-host genome | | primer_b | 30..52 | standard_name | RT-PCR probe: TM1789 | | note | FAM-CAGTACTGGGCCCTTGTGGCGCT-BHQ1 | | primer_b | complement(55..84) | standard_name | Primer reverse: PRIM1041 | | note | CATTGTGCTGAATAGGTTTATAGCTATGAT | | target | insert |
|
| Sequence information |
|---|
| Length: 84 BP, A Count: 28, C Count: 19, T Count: 21, G Count: 16 |
tcaaatcaac atgggtgact agaaannnnc agtactgggc ccttgtggcg ctnnatcata 60
gctataaacc tattcagcac aatg 84
|
