European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


ID   QT-EVE-GM-016; SV 0; linear; genomic DNA; STS; SYN; 87 BP.
XX
AC   MON-87751-7;
XX
DT   30-SEP-2014
DT   11-SEP-2019
XX
DE   Quantitative PCR method for detection of soybean event MON87751 (EURL GMFF, 2016).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event MON87751 (MON-87751-7)
XX
RN   [1]
RP   1-87
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-03-14-VR-Corrected-Version-1.pdf
RX   EURL_GMFF=EURL-VL-03-14-VP-Corrected-Version-1.pdf
XX
RN   [2]
RP   1-87
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-GM-016.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..87
FT                   /standard_name="PCR 87 bp amplicon"
FT                   /note="Event-specific RT-PCR;
FT                   /target="5' integration border region (IBR) between the insert of soybean event MON87751 and the soybean host genome";
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: MON 87751  primer 2"
FT                   /note="CTAAATTGCTCTTTGGAGTTTATTTTGTAG"
FT                   /target="5'-host genome"
FT   primer_bind     complement(34..62)
FT                   /standard_name="RT-PCR probe: MON 87751 probe"
FT                   /note="FAM-TGACTGGAGATCTCCAAAGTGAGGGGAAA-TAMRA"
FT   primer_bind     complement(64..87)
FT                   /standard_name="Primer reverse: MON 87751 primer 1"
FT                   /note="GGCCTAACTTTTGGTGTGATGATG"
FT                   /target="insert"
XX
SQ   Sequence 87 BP; 22 A; 21 C; 14 G; 30 T; 0 other;
     ctaaattgct ctttggagtt tattttgtag nnntttcccc tcactttgga gatctccagt        60
     cancatcatc acaccaaaag ttaggcc                                            87
//