European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-87701-2'
Entry information
Entry name QT-EVE-GM-010;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87701-2
Description
Description Quantitative PCR method for detection of soybean event MON87701 (Charels et al., 2011)
Keywords event_specific.
From Glycine max (soybean) - event MON87701 (MON-87701-2)
References
1 Charels D., Mazzara M., Grazioli E., Van den Eede G.; "Event-specific Method for the Quantification of Soybean Line MON87701 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
DOI 10.2788/38101
Reference Position 1-89
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-GM-010.pdf
Reference Position 1-89
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..89 standard_namePCR 89 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event MON87701 and the soybean host genome
primer_b 1..28 standard_namePrimer forward: MON 87701 primer 2
noteTGGTGATATGAAGATACATGCTTAGCAT
target5'-host genome
primer_b complement(35..64) standard_nameRT-PCR probe: MON 87701 probe
note6-FAM-TCAGTGTTTGACACACACACTAAGCGTGCC- TAMRA
primer_b complement(68..89) standard_namePrimer reverse: MON 87701 primer 1
noteCGTTTCCCGCCTTCAGTTTAAA
targetinsert
Sequence information
Length: 89 BP, A Count: 26, C Count: 16, T Count: 22, G Count: 25
tggtgatatg aagatacatg cttagcatnn nnnnggcacg cttagtgtgt gtgtcaaaca        60
ctgannnttt aaactgaagg cgggaaacg                                          89