Only one hit for query 'ac%3AMON-87769-7'
ID QT-EVE-GM-002; SV 0; linear; genomic DNA; STS; SYN; 87 BP. XX AC MON-87769-7; XX DT 30-OCT-2009 DT 07-FEB-2012 XX DE Quantitative PCR method for detection of soybean event MON87769 (Savini et al., 2012) XX KW event_specific. XX OS Glycine max (soybean) - event MON87769 (MON-87769-7) XX RN [1] RP 1-87 RA Savini C.,; RT "Event-specific Method for the Quantification of Soybean MON87769 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2012). RX EURL_GMFF=2012-01-27_CRLVL0709 MON87769_VP.pdf RX EURL_GMFF=2012-01-27_CRLVL0709 MON87769_VR.pdf XX RN [2] RP 1-87 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2012). RX PCR=QT-EVE-GM-002.pdf XX DR GMOMETHODS; QT-TAX-GM-002; XX FH Key Location/Qualifiers FH FT STS 1..87 FT /standard_name="PCR 87 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="3'integration border region (IBR) between the insert of soybean event MON87769 and the soybean host genome"; FT primer_bind 1..27 FT /standard_name="Primer forward: MON 87769 primer 1" FT /note="CATACTCATTGCTGATCCATGTAGATT" FT /target="insert"; FT primer_bind 29..56 FT /standard_name="RT-PCR probe: MON 87769 probe" FT /note="FAM-CCCGGACATGAAGCCATTTACAATTGAC-TAMRA" FT primer_bind complement(66..87) FT /standard_name="Primer reverse: MON 87769 primer 2" FT /note="GCAAGTTGCTCGTGAAGTTTTG" FT /target="3'-host genome"; XX SQ Sequence 87 BP; 27 A; 24 C; 12 G; 24 T; 0 other; catactcatt gctgatccat gtagattncc cggacatgaa gccatttaca attgacnnnn 60 nnnnncaaaa cttcacgagc aacttgc 87 //