Only one hit for query 'ac:DAS-81910-7'
ID QT-EVE-GH-011; SV 0; linear; genomic DNA; STD; SYN; 120 BP. XX AC DAS-81910-7; XX DT 07-OCT-2016 DT 10-DEC-2019 XX DE Quantitative PCR method for detection of cotton event DAS-81910-7 (EURL GMFF, 2019). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event DAS-81910-7 (DAS-81910-7) XX RN [1] RP 1-120 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton DAS-81910-7 Using Real-time PCR - Validation Report"; RL Online Publication (2019). RX EURL_GMFF=EURL-VL-06_16_VR.pdf RX EURL_GMFF=EURL-VL-06_16_VP.pdf XX RN [2] RP 1-120 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2019). RX PCR=QT-EVE-GH-011.pdf XX DR GMOMETHODS; QT-TAX-GH-021; DR GMOMETHODS; QT-TAX-GH-016; XX FH Key Location/Qualifiers FH FT STS 1..120 FT /standard_name="PCR 120 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="5' integration border region (IBR) between the insert of cotton event DAS-81910-7 and the cotton host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: 1706-f2" FT /note="AAGCTTAGGTGATTTCGATGATG" FT /target="5'-host genome" FT primer_bind 66..85 FT /standard_name="RT-PCR probe: 1706-p3" FT /note="FAM-CACACCAAAAGTTAGGCCCG-TAMRA" FT primer_bind complement(101..120) FT /standard_name="Primer reverse: 1706-r3" FT /note="GACCTCAATTGCGAGCTTTC" FT /target="insert" XX SQ Sequence 120 BP; 41 A; 19 C; 24 G; 36 T; 0 other; aagcttaggt gatttcgatg atgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnncacac caaaagttag gcccgnnnnn nnnnnnnnnn gaaagctcgc aattgaggtc 120 //