European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:DAS-81910-7'
Entry information
Entry name QT-EVE-GH-011;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DAS-81910-7
Description
Description Quantitative PCR method for detection of cotton event DAS-81910-7 (EURL GMFF, 2019).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event DAS-81910-7 (DAS-81910-7)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Cotton DAS-81910-7 Using Real-time PCR - Validation Report" Online Publication (2019)
EURL_GMFF EURL-VL-06_16_VR.pdf
EURL_GMFF EURL-VL-06_16_VP.pdf
Reference Position 1-120
2 "PCR reactions set up and amplification conditions" Online Publication (2019)
PCR QT-EVE-GH-011.pdf
Reference Position 1-120
Cross-references
GMOMETHODS QT-TAX-GH-021;
QT-TAX-GH-016;
Features
Key Location Qualifier Value
STS 1..120 standard_namePCR 120 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of cotton event DAS-81910-7 and the cotton host genome
primer_b 1..23 standard_namePrimer forward: 1706-f2
noteAAGCTTAGGTGATTTCGATGATG
target5'-host genome
primer_b 66..85 standard_nameRT-PCR probe: 1706-p3
noteFAM-CACACCAAAAGTTAGGCCCG-TAMRA
primer_b complement(101..120) standard_namePrimer reverse: 1706-r3
noteGACCTCAATTGCGAGCTTTC
targetinsert
Sequence information
Length: 120 BP, A Count: 41, C Count: 19, T Count: 36, G Count: 24
aagcttaggt gatttcgatg atgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnncacac caaaagttag gcccgnnnnn nnnnnnnnnn gaaagctcgc aattgaggtc       120