European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:BCS-GH004-7'
Entry information
Entry name QT-EVE-GH-009;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BCS-GH004-7
Description
Description Quantitative PCR method for detection of cotton event T304-40 (Nardini et al., 2012).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event T304-40 (BCS-GH004-7)
References
1 Nardini, E.,; "Event-specific Method for the Quantification of Cotton T304-40 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Cotton Seeds" Online Publication (2012)
EURL_GMFF 2012-10-29 EURL VL0511 VR.pdf
EURL_GMFF 2012-10-29 EURL VL0511 VP.pdf
Reference Position 1-78
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-GH-009.pdf
Reference Position 1-78
Cross-references
GMOMETHODS QT-TAX-GH-019;
Features
Key Location Qualifier Value
STS 1..78 standard_namePCR 78 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of cotton event T304-40 and the cotton host genome
primer_b 1..22 standard_namePrimer forward: SHA029
noteAGCGCGCAAACTAGGATAAATT
targetinsert
primer_b 24..46 standard_nameRT-PCR probe: TM089
note6-FAM-TCGCGCGCGGTGTCATCTATCTC-TAMRA
primer_b complement(52..78) standard_namePrimer reverse: SHA030
noteCCTAGATCTTGGGATAACTTGAAAAGA
target3'-host genome
Sequence information
Length: 78 BP, A Count: 19, C Count: 19, T Count: 25, G Count: 15
agcgcgcaaa ctaggataaa ttntcgcgcg cggtgtcatc tatctcnnnn ntcttttcaa        60
gttatcccaa gatctagg                                                      78