An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:BCS-GH004-7'
ID   QT-EVE-GH-009; SV 0; linear; genomic DNA; STS; SYN; 78 BP.
XX
AC   BCS-GH004-7;
XX
DT   16-NOV-2010
DT   24-JAN-2013
XX
DE   Quantitative PCR method for detection of cotton event T304-40 
DE   (Nardini et al., 2012).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event T304-40 (BCS-GH004-7)
XX
RN   [1]
RP   1-78
RA   Nardini, E.,;
RT   "Event-specific Method for the Quantification of Cotton T304-40 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Cotton Seeds";
RL   Online Publication (2012).
RX   EURL_GMFF=2012-10-29 EURL VL0511 VR.pdf
RX   EURL_GMFF=2012-10-29 EURL VL0511 VP.pdf
XX
RN   [2]
RP   1-78
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-GH-009.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-019;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..78
FT                   /standard_name="PCR 78 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of cotton event T304-40 and the cotton host genome"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: SHA029"
FT                   /note="AGCGCGCAAACTAGGATAAATT"
FT                   /target="insert"
FT   primer_bind     24..46
FT                   /standard_name="RT-PCR probe: TM089"
FT                   /note="6-FAM-TCGCGCGCGGTGTCATCTATCTC-TAMRA"
FT   primer_bind     complement(52..78)
FT                   /standard_name="Primer reverse: SHA030"
FT                   /note="CCTAGATCTTGGGATAACTTGAAAAGA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 78 BP; 19 A; 19 C; 15 G; 25 T; 0 other;
     agcgcgcaaa ctaggataaa ttntcgcgcg cggtgtcatc tatctcnnnn ntcttttcaa        60
     gttatcccaa gatctagg                                                      78
//