Only one hit for query 'ac:BCS-GH002-5'
Entry information |
Entry name | QT-EVE-GH-006; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | BCS-GH002-5 |
Description |
Description | Quantitative PCR method for detection of cotton event GHB614 (Savini et al., 2008). |
Keywords | event_specific. |
From | Gossypium hirsutum (upland cotton) - event GHB614 (BCS-GH002-5) |
References |
1 | Savini C., Bogni A., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Cotton Line GHB614 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-TAX-GH-019; |
Features |
Key | Location | Qualifier | Value | STS | 1..120 | standard_name | PCR 120 bp amplicon | note | event-specific RT-PCR | target | 3' integration border region (IBR) between the insert of cotton event GHB614 and the cotton host genome | primer_b | 1..24 | standard_name | Primer forward: SHA007 | note | CAAATACACTTGGAACGACTTCGT | target | insert | primer_b | 31..60 | standard_name | RT-PCR probe: TM072 | note | FAM-CTCCATGGCGATCGCTACGTTCTAGAATT-TAMRA | note | The probe sequence provided by the applicant is missing a nucleotide at position 51 of the amplicon according to patent sequence accession no. CS492094 | primer_b | complement(100..120) | standard_name | Primer reverse: SHA008 | note | GCAGGCATGCAAGCTTTTAAA | target | 3'-host genome |
|
Sequence information |
Length: 120 BP, A Count: 20, C Count: 19, T Count: 22, G Count: 14 |
caaatacact tggaacgact tcgtnnnnnn ctccatggcg atcgctacgt ntctagaatt 60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnt ttaaaagctt gcatgcctgc 120
|