Only one hit for query 'ac:DAS-21023-5'
Entry information |
Entry name | QT-EVE-GH-001b; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | DAS-21023-5 |
Description |
Description | Quantitative PCR method for detection of cotton event 3006-210-23 (Mazzara et al., 2006). |
Keywords | event_specific. |
From | Gossypium hirsutum (upland cotton) - event 3006-210-23 (DAS-21023-5) |
References |
1 | Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds" Online Publication (2006) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-TAX-GH-016; |
QT-TAX-GH-021; |
Features |
Key | Location | Qualifier | Value | STS | 1..90 | standard_name | PCR 90 bp amplicon | note | event-specific RT-PCR | target | 5' integration border region (IBR) between the insert of cotton event 3006-210-23 and the cotton host genome | primer_b | 1..27 | standard_name | Primer forward: 3006-f3 | note | AAATATTAACAATGCATTGAGTATGATG | target | 5'-host genome | primer_b | complement(31..60) | standard_name | RT-PCR probe: 3006-s2 | note | FAM- TACTCATTGCTGATCCATGTAGATTTCCCG-TAMRA | primer_b | complement(65..90) | standard_name | Primer reverse: 3006-r2 | note | ACTCTTTCTTTTTCTCCATATTGACC | target | insert |
|
Sequence information |
Length: 90 BP, A Count: 36, C Count: 8, T Count: 19, G Count: 20 |
aaatattaac aatgcattga gtatgatgnn cgggaaatct acatggatca gcaatgagta 60
nnnnggtcaa tatggagaaa aagaaagagt 90
|