Only one hit for query 'ac%3ADAS-21023-5'
ID QT-EVE-GH-001b; SV 0; linear; genomic DNA; STS; SYN; 90 BP. XX AC DAS-21023-5; XX DT 01-JAN-1900 DT 17-NOV-2010 XX DE Quantitative PCR method for detection of cotton event 3006-210-23 DE (Mazzara et al., 2006). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event 3006-210-23 (DAS-21023-5) XX RN [1] RP 1-90 RA Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; RT "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds"; RL Online Publication (2006). RX DOI=10.2788/32649 XX RN [2] RP 1-90 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-001b.pdf XX DR GMOMETHODS; QT-TAX-GH-016; DR GMOMETHODS; QT-TAX-GH-021; XX FH Key Location/Qualifiers FH FT STS 1..90 FT /standard_name="PCR 90 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of cotton event 3006-210-23 and the cotton host genome" FT primer_bind 1..27 FT /standard_name="Primer forward: 3006-f3" FT /note="AAATATTAACAATGCATTGAGTATGATG" FT /target="5'-host genome" FT primer_bind complement(31..60) FT /standard_name="RT-PCR probe: 3006-s2" FT /note="FAM-TACTCATTGCTGATCCATGTAGATTTCCCG-TAMRA" FT primer_bind complement(65..90) FT /standard_name="Primer reverse: 3006-r2" FT /note="ACTCTTTCTTTTTCTCCATATTGACC" FT /target="insert" XX SQ Sequence 90 BP; 36 A; 8 C; 20 G; 19 T; 7 other; aaatattaac aatgcattga gtatgatgnn cgggaaatct acatggatca gcaatgagta 60 nnnnggtcaa tatggagaaa aagaaagagt 90 //