An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:BCS-BN012-7'
ID   QT-EVE-BN-011; SV 0; linear; genomic DNA; STD; PLN; 124 BP.
AC   BCS-BN012-7;
DT   19-FEB-2019
DT   14-FEB-2019
DE   Quantitative PCR method for detection of oilseed rape event MS11 (Jacchia et al., 2019).
KW   event_specific.
OS   Brassica napus (oilseed rape) - event MS11 (BCS-BN012-7)
RN   [1]
RP   1-124
RA   Jacchia S., Sacco M.G., Savini C., Mazzara M., Emons H.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MS11 Using
RT   Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2019).
RN   [2]
RP   1-124
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2019).
RX   PCR=QT-EVE-BN-011.pdf
FH   Key             Location/Qualifiers
FT   STS             1..124
FT                   /standard_name="PCR 124 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3'integration border region (IBR) between the insert of oilseed rape event MS11 and the oilseed rape host genome";
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: SHA086"
FT                   /target="insert"
FT   primer_bind     40..59
FT                   /standard_name="RT-PCR probe: TM280"
FT                   /note="FAM-CGACCATGTACATCCTACCA-MGB"
FT   primer_bind     complement(102..124)
FT                   /standard_name="Primer reverse: MDB371"
FT                   /note="GAAATCCATGTAAAGCAGCAGGG"
FT                   /target="3'-host genome"
SQ   Sequence 124 BP; 39 A; 27 C; 15 G; 43 T; 0 other;
     caagatggga attaacatct acaaattgnn nnnnnnnnnc gaccatgtac atcctaccan        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nccctgctgc tttacatgga       120
     tttc                                                                    124