European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:BCS-BN012-7'
ID   QT-EVE-BN-011; SV 0; linear; genomic DNA; STD; PLN; 124 BP.
XX
AC   BCS-BN012-7;
XX
DT   19-FEB-2019
DT   14-FEB-2019
XX
DE   Quantitative PCR method for detection of oilseed rape event MS11 (Jacchia et al., 2019).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event MS11 (BCS-BN012-7)
XX
RN   [1]
RP   1-124
RA   Jacchia S., Sacco M.G., Savini C., Mazzara M., Emons H.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MS11 Using
RT   Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2019).
RX   EURL_GMFF=EURL-VL-03-16-VR.pdf
RX   EURL_GMFF=EURL-VL-03-16-VM.pdf
XX
RN   [2]
RP   1-124
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2019).
RX   PCR=QT-EVE-BN-011.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..124
FT                   /standard_name="PCR 124 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3'integration border region (IBR) between the insert of oilseed rape event MS11 and the oilseed rape host genome";
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: SHA086"
FT                   /note="CAAGATGGGAATTAACATCTACAAATTG"
FT                   /target="insert"
FT   primer_bind     40..59
FT                   /standard_name="RT-PCR probe: TM280"
FT                   /note="FAM-CGACCATGTACATCCTACCA-MGB"
FT   primer_bind     complement(102..124)
FT                   /standard_name="Primer reverse: MDB371"
FT                   /note="GAAATCCATGTAAAGCAGCAGGG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 124 BP; 39 A; 27 C; 15 G; 43 T; 0 other;
     caagatggga attaacatct acaaattgnn nnnnnnnnnc gaccatgtac atcctaccan        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nccctgctgc tttacatgga       120
     tttc                                                                    124
//