Only one hit for query 'ac%3ABCS-BN012-7'
ID QT-EVE-BN-011; SV 0; linear; genomic DNA; STD; PLN; 124 BP. XX AC BCS-BN012-7; XX DT 19-FEB-2019 DT 14-FEB-2019 XX DE Quantitative PCR method for detection of oilseed rape event MS11 (Jacchia et al., 2019). XX KW event_specific. XX OS Brassica napus (oilseed rape) - event MS11 (BCS-BN012-7) XX RN [1] RP 1-124 RA Jacchia S., Sacco M.G., Savini C., Mazzara M., Emons H.; RT "Event-specific Method for the Quantification of Oilseed Rape MS11 Using RT Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2019). RX EURL_GMFF=EURL-VL-03-16-VR.pdf RX EURL_GMFF=EURL-VL-03-16-VM.pdf XX RN [2] RP 1-124 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2019). RX PCR=QT-EVE-BN-011.pdf XX DR GMOMETHODS; QT-TAX-BN-003; XX FH Key Location/Qualifiers FH FT STS 1..124 FT /standard_name="PCR 124 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3'integration border region (IBR) between the insert of oilseed rape event MS11 and the oilseed rape host genome"; FT primer_bind 1..28 FT /standard_name="Primer forward: SHA086" FT /note="CAAGATGGGAATTAACATCTACAAATTG" FT /target="insert" FT primer_bind 40..59 FT /standard_name="RT-PCR probe: TM280" FT /note="FAM-CGACCATGTACATCCTACCA-MGB" FT primer_bind complement(102..124) FT /standard_name="Primer reverse: MDB371" FT /note="GAAATCCATGTAAAGCAGCAGGG" FT /target="3'-host genome" XX SQ Sequence 124 BP; 39 A; 27 C; 15 G; 43 T; 0 other; caagatggga attaacatct acaaattgnn nnnnnnnnnc gaccatgtac atcctaccan 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nccctgctgc tttacatgga 120 tttc 124 //