European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.

Perform your search by inserting a key word or by selecting a GMO unique identifier.

Only one hit for query 'ac:MON-88302-9'
ID   QT-EVE-BN-010; SV 0; linear; genomic DNA; STS; SYN; 101 BP.
AC   MON-88302-9;
DT   13-SEP-2011
DT   03-DEC-2013
DE   Quantitative PCR method for detection of oilseed rape event MON88302 (Savini et al., 2013).
KW   event_specific.
OS   Brassica napus (oilseed rape)- event MON88302 (MON-88302-9)
RN   [1]
RP   1-101
RA   Savini C., et al.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   EURL_GMFF=EURL-VL-09-11-VR-MON88302.pdf
RX   EURL_GMFF=EURL-VL-09-11-VM-MON88302.pdf
RN   [2]
RP   1-101
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QT-EVE-BN-010.pdf
FH   Key             Location/Qualifiers
FT   STS             1..101
FT                   /standard_name="PCR 101 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of oilseed rape event MON88302 and the oilseed rape host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: 88302QF"
FT                   /target="5'-host genome"
FT   primer_bind     36..65
FT                   /standard_name="RT-PCR probe: 88302QP"
FT   primer_bind     complement(78..101)
FT                   /standard_name="Primer reverse: 88302QR"
FT                   /note="TCAGATTGTCGTTTCCCGCCTTCA"
FT                   /target="insert"
SQ   Sequence 101 BP; 33 A; 21 C; 16 G; 31 T; 0 other;
     tccttgaacc ttattttata gtgcacannn nnnnntagtc atcatgttgt accacttcaa        60
     acactnnnnn nnnnnnntga aggcgggaaa cgacaatctg a                           101