ID QT-EVE-BN-004; SV 0; linear; genomic DNA; STS; PLN; 108 BP. XX AC MON-00073-7; XX DT 01-JAN-1900 DT 19-OCT-2010 XX DE Quantitative PCR method for detection of oilseed rape event GT73 DE (Mazzara et al., 2007). XX KW event_specific. XX OS Brassica napus (oilseed rape) - event GT73 (MON-00073-7) XX RN [1] RP 1-108 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction of Oilseed Rape; RL Online Publication (2007). RX DOI=10.2788/33974 XX RN [2] RP 1-108 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-BN-004.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..108 FT /standard_name="PCR 108 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of oilseed rape event GT73 and the oilseed rape host genome" FT primer_bind 1..26 FT /standard_name="Primer forward: RT73 primer 1" FT /note="CCATATTGACCATCATACTCATTGCT" FT /target="insert" FT primer_bind 40..66 FT /standard_name="RT-PCR probe: RT73 Probe" FT /note="FAM-TTCCCGGACATGAAGATCATCCTCCTT-TAMRA" FT primer_bind complement(85..108) FT /standard_name="Primer reverse: RT73 primer 2" FT /note="GCTTATACGAAGGCAAGAAAAGGA" FT /target="3'-host genome" XX SQ Sequence 108 BP; 16 A; 24 C; 9 G; 28 T; 31 other; ccatattgac catcatactc attgctnnnn nnnnnnnnnt tcccggacat gaagatcatc 60 ctccttnnnn nnnnnnnnnn nnnntccttt tcttgccttc gtataagc 108 //