European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-ZM-002;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of maize alcoholdeydrogenase 1 gene (Barbau-Piednoir et al., 2014).
Keywords taxon_specific, validated_in_combination.
From Zea mays (maize)
References
1 Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., Van den Bulcke M.; "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR Screening(CoSYPS)" Food Analitical Methods 0:0-0 (2014)
DOI 10.1007/s12161-014-9837-3
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QL-TAX-ZM-002.pdf
Reference Position 1-84
3 "See Cross-references below" Online Publication (2014)
Reference Position 1-84
Cross-references
GMOMETHODS QL-ELE-00-017;
QL-ELE-00-018;
QL-ELE-00-019;
QL-ELE-00-020;
QL-ELE-00-021;
QL-ELE-00-022;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
notetaxon-specific PCR for maize
targetalcohol dehydrogenase 1 (adh1) gene
primer_b 1..27 standard_namePrimer forward: ADH_alt Fwd
noteTCTCTTCCTCCTTTAGAGCTACCACTA
targetadh1
primer_b complement(64..84) standard_namePrimer reverse: ADH_alt Rev
noteAATCGATCCAAAGCGAGATGA
targetadh1
Sequence information
Length: 84 BP, A Count: 16, C Count: 26, T Count: 30, G Count: 12
tctcttcctc ctttagagct accactannn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnntcatctc gctttggatc gatt                                               84