Only one hit for query 'ql-tax-ps-001'
ID QL-TAX-PS-001; SV 1; linear; genomic DNA; STD; PLN; 78 BP. XX AC ; XX DT 30-JUL-2008 DT 22-DEC-2016 XX DE Qualitative PCR method for detection of pea lectin gene (Debode et al., 2016). XX KW taxon_specific, validated_independently. XX OS Pisum sativum (pea) XX RN [1] RP 1-78 RA Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; RT " Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection"; RL Food Control 73:452-461 (2017). RX DOI=10.1016/j.foodcont.2016.08.037. XX RN [2] RP 1-78 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QL-TAX-PS-001.pdf XX FH Key Location/Qualifiers FH FT STS 1..78 FT /standard_name="PCR 78 bp amplicon" FT /note="taxon-specific RT-PCR for pea" FT /target="pea lectin (psl) gene" FT primer_bind 1..24 FT /standard_name="Primer forward: lecPea1-F" FT /note="TGGAATCGATGTGAACAGTATCAA" FT /target="psl" FT primer_bind 26..52 FT /standard_name="RT-PCR probe: lecPea1-P" FT /note="FAM-TCCGTAAACACTAAGTCGTGGAAGTTG-TAMRA" FT primer_bind complement(54..78) FT /standard_name="Primer reverse: lecPea1-R" FT /note="ACAACATTAGCCTCTTCACCATTCT" FT /target="psl" XX SQ Sequence 78 BP; 26 A; 10 C; 22 G; 20 T; 0 other; tggaatcgat gtgaacagta tcaaatccgt aaacactaag tcgtggaagt tgcagaatgg 60 tgaagaggct aatgttgt 78 //