An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-TAX-LU-001; SV 1; linear; genomic DNA; STD; PLN; 68 BP.
XX
AC   ;
XX
DT   28-NOV-2012
DT   01-DEC-2016
XX
DE   Qualitative PCR method for detection of flax stearoyl-acyl carrier protein desaturase gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Linum usitatissimum (flax)
XX
RN   [1]
RP   1-68
RA   Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.;
RT   "Collaborative trial validation of a construct-specific real-time PCR
RT   method for detection of genetically modified linseed event 'CDC Triffid'
RT   FP967";
RL   Eur Food Res Technol 232:557-561 (2011).
RX   DOI=10.1007/s00217-010-1403-7
XX
RN   [2]
RP   1-68
RT   "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products";
RL   ISO/TS 21569-2:1-9 (2012).
RX   ISO=60166
XX
RN   [3]
RP   1-68
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR ";
RL   Online Publication (2009).
RX   CRL-DOC=Flax-CDCTriffidFlaxJRC091030.pdf
RX   CRL-DOC=Flax_FP967_verification_report.pdf
XX
RN   [4]
RP   1-68
RT   "See Cross-references below";
RL   Online Publication (2016).
XX
DR   GMOMETHODS; QL-CON-00-010;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..68
FT                   /standard_name="PCR 68 bp amplicon"
FT                   /note="taxon-specific RT-PCR for flax"
FT                   /target="stearoyl-acyl carrier protein desaturase (sad) gene"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: SAD FW primer"
FT                   /note="GCTCAACCCAGTCACCACCT"
FT                   /target="sad"
FT   primer_bind     complement(21..44)
FT                   /standard_name="RT-PCR probe: SAD probe"
FT                   /note="FAM-TGTTGAGGGAGCGTGTTGAAGGGA-BHQ"
FT   misc_difference 28..31
FT                   /note="A mismatch of two nucleotides at position 28 (G instead of A) and 31 (C instead of A) is present between the probe sequence and a variant of the sad gene (sad2) with GenBank accession number AJ006958(position 173 and 176 of the gene sequence), a perfect match can be observed instead with the sad gene having GenBank accession number X70962"
FT   primer_bind     complement(49..68)
FT                   /standard_name="Primer reverse: SAD RV primer"
FT                   /note="TGCGAGGAGATCTGGAGGAG"
FT                   /target="sad"
XX
SQ   Sequence 68 BP; 15 A; 33 C; 5 G; 15 T; 0 other;
     gctcaaccca gtcaccacct tcccttcaac acgctccctc aacannnnct cctccagatc        60
     tcctcgca                                                                68
//