European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:BCS-OS003-7'
Entry information
Entry name QL-EVE-OS-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BCS-OS003-7
Description
Description Qualitative PCR method for detection of rice event LLRICE601 (verified by the EU-RL GMFF in the context of Commission Decision 2006/578/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Oryza sativa (rice) - event LLRICE601 (BCS-OS003-7)
References
1 Mazzara M., Cordeil S., Van den Eede G.; "Report on the Verification of an Event-specific Detection Method for Identification of Rice GM-Event LLRICE601 Using a Real-time PCR Assay" Online Publication (2006)
EURL_GMFF Verification Report LLRice601 event.pdf
Reference Position 1-66
2 Mazzara M., Cordeil S., Van den Eede G.; "Addendum to the Report on the Verification of an Event-specific Detection Method for Identification of Rice GM-Event LLRICE601 Using a Real-time PCR Assay" Online Publication (2006)
EURL_GMFF Verification Report LLRice601 event addendum on Table 4.pdf
Reference Position 1-66
3 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QL-EVE-OS-001.pdf
Reference Position 1-66
Cross-references
GMOMETHODS QL-TAX-OS-002;
Features
Key Location Qualifier Value
STS 1..66 standard_namePCR 66 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of rice event LLRICE601 and the rice host genome
primer_b 1..22 standard_namePrimer forward: SHA040
noteTCTAGGATCCGAAGCAGATCGT
targetinsert
primer_b 24..49 standard_nameRT-PCR probe: TM098
noteFAM-CCACCTCCCAACAATAAAAGCGCCTG-TAMRA
primer_b complement(51..66) standard_namePrimer reverse: SHA041
noteGGAGGGCGCGGAGTGT
target3'-host genome
Sequence information
Length: 66 BP, A Count: 17, C Count: 27, T Count: 11, G Count: 11
tctaggatcc gaagcagatc gtnccacctc ccaacaataa aagcgcctgn acactccgcg        60
ccctcc                                                                   66