European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:BCS-OS003-7'
ID   QL-EVE-OS-001; SV 0; linear; genomic DNA; STS; SYN; 66 BP.
XX
AC   BCS-OS003-7;
XX
DT   06-DEC-2011
DT   26-FEB-2008
XX
DE   Qualitative PCR method for detection of rice event LLRICE601 (verified by the EU-RL GMFF in the context of Commission Decision 2006/578/EC)
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Oryza sativa (rice) - event LLRICE601 (BCS-OS003-7)
XX
RN   [1]
RP   1-66
RA   Mazzara M., Cordeil S., Van den Eede G.;
RT   "Report on the Verification of an Event-specific Detection Method for
RT   Identification of Rice GM-Event LLRICE601 Using a Real-time PCR Assay";
RL   Online Publication (2006).
RX   EURL_GMFF=Verification Report LLRice601 event.pdf
XX
RN   [2]
RP   1-66
RA   Mazzara M., Cordeil S., Van den Eede G.;
RT   "Addendum to the Report on the Verification of an Event-specific
RT   Detection Method for Identification of Rice GM-Event LLRICE601 Using a
RT   Real-time PCR Assay";
RL   Online Publication (2006).
RX   EURL_GMFF=Verification Report LLRice601 event addendum on Table 4.pdf
XX
RN   [3]
RP   1-66
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QL-EVE-OS-001.pdf
XX
DR   GMOMETHODS; QL-TAX-OS-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..66
FT                   /standard_name="PCR 66 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of rice event LLRICE601 and the rice host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: SHA040"
FT                   /note="TCTAGGATCCGAAGCAGATCGT"
FT                   /target="insert";
FT   primer_bind     24..49
FT                   /standard_name="RT-PCR probe:  TM098"
FT                   /note="FAM-CCACCTCCCAACAATAAAAGCGCCTG-TAMRA"
FT   primer_bind     complement(51..66)
FT                   /standard_name="Primer reverse: SHA041"
FT                   /note="GGAGGGCGCGGAGTGT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 66 BP; 17 A; 27 C; 11 G; 11 T; 0 other;
     tctaggatcc gaagcagatc gtnccacctc ccaacaataa aagcgcctgn acactccgcg        60
     ccctcc                                                                   66
//