European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:FLO-40685-2'
ID   QL-EVE-DC-006; SV 0; linear; genomic DNA; STD; SYN; 338 BP.
XX
AC   FLO-40685-2;
XX
DT   25-OCT-2013
DT   08-DEC-2017
XX
DE   Qualitative PCR method for detection of carnation event 123.8.8 (verified by the EURL GMFF, 2016).
XX
KW   event_specific, EURL_GMFF_in-house_verified.
XX
OS   Dianthus caryophyllus (carnation) - event 123.8.8 (FLO-40685-2)
XX
RN   [1]
RP   1-338
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of GM-line FLO-40685-2 Carnation - JRC Validated Methods, Reference Methods and Measurement Reports";
RL   Online Publication (2016).
RX   EURL_2001=EURL-EV-02-13-VR.pdf
XX
RN   [2]
RP   1-338
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-EVE-DC-006.pdf
XX
DR   GMOMETHODS; QL-TAX-DC-001;
XX
CC   NOTE: This GMO was formerly referred to with the FLO-40685-1 Unique
CC   identifiers (UI) which OECD corrected (JAN 2015).
XX
FH   Key             Location/Qualifiers
FH                   
FT   STS             1..338
FT                   /standard_name="PCR 338 bp amplicon"
FT                   /note="Event-specific PCR for the second insertion site
FT                   of GMO event 123.8.8 carnation";
FT                   /target="3' integration border region (IBR) between the insert of carnation event 123.8.8 and the carnation host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: RBF1a"
FT                   /note="TGGTGGACCCTTGAGGAAACTG"
FT                   /target="insert"
FT   primer_bind     complement(317..338)
FT                   /standard_name="Primer reverse: 123.8.8-2.1R"
FT                   /note="ATACAATGGCTGACTGATGTAG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 338 BP; 90 A; 60 C; 82 G; 106 T; 0 other;
     tggtggaccc ttgaggaaac tgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnctac atcagtcagc cattgtat                               338
//