An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:FLO-40685-2'
ID   QL-EVE-DC-006; SV 0; linear; genomic DNA; STD; SYN; 338 BP.
XX
AC   FLO-40685-2;
XX
DT   25-OCT-2013
DT   08-DEC-2017
XX
DE   Qualitative PCR method for detection of carnation event 123.8.8 (verified by the EURL GMFF, 2016).
XX
KW   event_specific, EURL_GMFF_in-house_verified.
XX
OS   Dianthus caryophyllus (carnation) - event 123.8.8 (FLO-40685-2)
XX
RN   [1]
RP   1-338
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of GM-line FLO-40685-2 Carnation - JRC Validated Methods, Reference Methods and Measurement Reports";
RL   Online Publication (2016).
RX   EURL_2001=EURL-EV-02-13-VR.pdf
XX
RN   [2]
RP   1-338
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-EVE-DC-006.pdf
XX
DR   GMOMETHODS; QL-TAX-DC-001;
XX
CC   NOTE: This GMO was formerly referred to with the FLO-40685-1 Unique
CC   identifiers (UI) which OECD corrected (JAN 2015).
XX
FH   Key             Location/Qualifiers
FH                   
FT   STS             1..338
FT                   /standard_name="PCR 338 bp amplicon"
FT                   /note="Event-specific PCR for the second insertion site
FT                   of GMO event 123.8.8 carnation";
FT                   /target="3' integration border region (IBR) between the insert of carnation event 123.8.8 and the carnation host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: RBF1a"
FT                   /note="TGGTGGACCCTTGAGGAAACTG"
FT                   /target="insert"
FT   primer_bind     complement(317..338)
FT                   /standard_name="Primer reverse: 123.8.8-2.1R"
FT                   /note="ATACAATGGCTGACTGATGTAG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 338 BP; 90 A; 60 C; 82 G; 106 T; 0 other;
     tggtggaccc ttgaggaaac tgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnctac atcagtcagc cattgtat                               338
//