European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-022;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of phosphinothricin N-acetyltransferase (bar) gene (Barbau-Piednoir et al., 2014).
Keywords element_specific.
1 Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., Van den Bulcke M.; "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR Screening(CoSYPS)" Food Analitical Methods 0:0-0 (2014)
DOI 10.1007/s12161-014-9837-3
Reference Position 1-69
2 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QL-ELE-00-022.pdf
Reference Position 1-69
Cross-references
GMOMETHODS QL-TAX-BN-003;
QL-TAX-GM-001;
QL-TAX-ZM-002;
QL-PLN-00-006;
Features
Key Location Qualifier Value
misc_fea 1..69 noteSybricon007 insert containing Streptomyces hygroscopicus partial bar gene
STS 1..69 standard_namePCR 69 bp amplicon
noteelement-specific PCR
targetphosphinothricin N-acetyl transferase (bar) gene from bacterium Streptomyces hygroscopicus
primer_b 1..23 standard_namePrimer forward: Pat-Bar Fwd
noteCGTCAACCACTACATCGAGACAA
targetbar
primer_b complement(51..69) standard_namePrimer reverse: Pat-Bar Rev
noteGTCCACTCCTGCGGTTCCT
targetbar
Sequence information
Length: 69 BP, A Count: 20, C Count: 23, T Count: 8, G Count: 18
cgtcaaccac tacatcgaga caannnnnnn nnnnnnnnnn nnnnnnnnnn aggaaccgca        60
ggagtggac                                                                69