ID QL-ELE-00-015; SV 1; linear; genomic DNA; STD; VRT; 78 BP. XX AC ; XX DT 19-AUG-1988 DT 10-MAY-2017 XX DE Qualitative PCR method for detection of Figwort Mosaic Virus 35S promoter XX KW element_specific. XX RN [1] RP 1-78 RT "Detection of a DNA sequence of the FMV-promoter (pFMV) in foodstuffs with real-time PCR"; RL BVL L 00.00-148:2014-02(2014). RX BVL=bvl-l-0000-148/202225005 XX RN [2] RP 1-78 RT "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products -- Part 5: Real-time PCR based screening method for the detection of the FMV promoter (P-FMV) DNA sequence"; RL ISO/TS 21569-5:2016 (2016). RX ISO=69340 XX RN [3] RP 1-78 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-015.pdf XX FH Key Location/Qualifiers FH FT STS 1..78 FT /standard_name="PCR 78 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Figwort Mosaic Virus 35S promoter (P-FMV)" FT primer_bind 1..22 FT /standard_name="Primer forward: pFMV-F" FT /note="CAAAATAACGTGGAAAAGAGCT" FT /target="P-FMV" FT primer_bind 26..47 FT /standard_name="RT-PCR probe: Probe pFMV" FT /note="FAM-CTGACAGCCCACTCACTAATGC-BHQ1" FT primer_bind complement(59..78) FT /standard_name="Primer reverse: pFMV-R" FT /note="TCTTTTGTGGTCGTCACTGC" FT /target="P-FMV" XX SQ Sequence 78 BP; 30 A; 20 C; 17 G; 11 T; 0 other; caaaataacg tggaaaagag ctnnnctgac agcccactca ctaatgcnnn nnnnnnnngc 60 agtgacgacc acaaaaga 78 //