ID QL-ELE-00-002; SV 0; linear; genomic DNA; STS; SYN; 215 BP. XX AC ; XX DT 23-JUN-2009 DT 11-JAN-2018 XX DE Qualitative PCR method for detection of Neomycin phosphotransferase II (ntpII) gene DE (ISO/FDIS 21569:2005). XX KW element_specific. XX RN [1] RP 1-215 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-215 RA Collection of Official Methods under Article 35 of the German Federal Foods Act; RT "Screening procedure for the detection of genetically modified DNA RT sequences in foods by identification of DNA sequences that frequently RT occur in genetically modified organisms"; RL Food Analysis, L 00.00-31, Beuth, Berlin Koln (1998). XX RN [3] RP 1-215 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-002.pdf XX FH Key Location/Qualifiers FH FT STS 1..215 FT /standard_name="PCR 215 bp amplicon" FT /note="element-specific PCR" FT /target="Neomycin phosphotransferase II (nptII) gene" FT primer_bind 1..21 FT /standard_name="Primer forward: APH2 short" FT /note="CTCACCTTGCTCCTGCCGAGA" FT /target="nptII" FT primer_bind complement(195..215) FT /standard_name="Primer reverse: APH2 reverse" FT /note="CGCCTTGAGCCTGGCGAACAG" FT /target="nptII" XX SQ Sequence 215 BP; 6 A; 16 C; 11 G; 9 T; 173 other; ctcaccttgc tcctgccgag annnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180 nnnnnnnnnn nnnnctgttc gccaggctca aggcg 215 //