European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ql-con-00-014'
ID   QL-CON-00-014; SV 1; linear; genomic DNA; STD; SYN; 170 BP.
XX
AC   ;
XX
DT   22-DEC-2008
DT   08-JUN-2017
XX
DE   Qualitative PCR method for detection of the junction between the nos promoter and the neomycin phosphotransferase II gene
XX
KW   construct_specific.
XX
OS   Carica papaya (papaya) - event Sunup-Papaya 55-1
XX
RN   [1]
RP   1-170
RT   "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products - Part 4: Real-time PCR based screening methods for the detection of the P-nos and P-nos-nptII DNA sequences";
RL   ISO/TS 21569-4:2016 (2016).
RX   ISO=69339
XX
RN   [2]
RP   1-170
RT   "Detection of a DNA sequence junction between the nos-promoter and the nptII-gene for screening of genetically modified organism using real-time PCR";
RL   BVL L 00.00-142:2013-01 Food Analysis, Beuth, Berlin Koln (2013).
RX   BVL=bvl-l-00-00-142/179718833
XX
RN   [3]
RP   1-170
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-CON-00-014.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..170
FT                   /standard_name="PCR 144-170 bp amplicon"
FT                   /note="Construct-specific RT-PCR"
FT                   /target="Junction region between the nopaline synthase promoter (P-nos) from Agrobacterium tumefaciens and the neomycin phosphotransferase II (nptII) gene"
FT   misc_feature    1..170
FT                   /note="The fragment size generated by the P-nos-nptII PCR depends on the assembly of the two sequence elements and is varying in the different GM plant events"
FT   primer_bind     1..22
FT                   /standard_name="Primer reverse: nptII-R"
FT                   /note="GATTGTCTGTTGTGCCCAGTCA"
FT                   /target="nptII gene"
FT   primer_bind     24..48
FT                   /standard_name="RT-PCR probe: nptII-Tm2"
FT                   /note="FAM-AGCCGAATAGCCTCTCCACCCAAGC-BBQ"
FT   primer_bind     complement(148..170)
FT                   /standard_name="Primer forward: pnos-F2"
FT                   /note="TTCCCCTCGGTATCCAATTAGAG"
FT                   /target="P-nos"
XX
SQ   Sequence 170 BP; 47 A; 34 C; 50 G; 39 T; 0 other;
     gattgtctgt tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc        60
     tgcccggatc cgggcggaaa taggtaaaga agttgcggat aaggtaattg ccattgcaga       120
     ttatttggat tgagagtgaa tatgagactc taattggata ccgaggggaa                  170
//