Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ql-con-00-014'
ID   QL-CON-00-014; SV 1; linear; genomic DNA; STD; SYN; 170 BP.
XX
AC   ;
XX
DT   22-DEC-2008
DT   08-JUN-2017
XX
DE   Qualitative PCR method for detection of the junction between the nos promoter and the neomycin phosphotransferase II gene
XX
KW   construct_specific.
XX
OS   Carica papaya (papaya) - event Sunup-Papaya 55-1
XX
RN   [1]
RP   1-170
RT   "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products - Part 4: Real-time PCR based screening methods for the detection of the P-nos and P-nos-nptII DNA sequences";
RL   ISO/TS 21569-4:2016 (2016).
RX   ISO=69339
XX
RN   [2]
RP   1-170
RT   "Detection of a DNA sequence junction between the nos-promoter and the nptII-gene for screening of genetically modified organism using real-time PCR";
RL   BVL L 00.00-142:2013-01 Food Analysis, Beuth, Berlin Koln (2013).
RX   BVL=bvl-l-00-00-142/179718833
XX
RN   [3]
RP   1-170
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-CON-00-014.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..170
FT                   /standard_name="PCR 144-170 bp amplicon"
FT                   /note="Construct-specific RT-PCR"
FT                   /target="Junction region between the nopaline synthase promoter (P-nos) from Agrobacterium tumefaciens and the neomycin phosphotransferase II (nptII) gene"
FT   misc_feature    1..170
FT                   /note="The fragment size generated by the P-nos-nptII PCR depends on the assembly of the two sequence elements and is varying in the different GM plant events"
FT   primer_bind     1..22
FT                   /standard_name="Primer reverse: nptII-R"
FT                   /note="GATTGTCTGTTGTGCCCAGTCA"
FT                   /target="nptII gene"
FT   primer_bind     24..48
FT                   /standard_name="RT-PCR probe: nptII-Tm2"
FT                   /note="FAM-AGCCGAATAGCCTCTCCACCCAAGC-BBQ"
FT   primer_bind     complement(148..170)
FT                   /standard_name="Primer forward: pnos-F2"
FT                   /note="TTCCCCTCGGTATCCAATTAGAG"
FT                   /target="P-nos"
XX
SQ   Sequence 170 BP; 47 A; 34 C; 50 G; 39 T; 0 other;
     gattgtctgt tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc        60
     tgcccggatc cgggcggaaa taggtaaaga agttgcggat aaggtaattg ccattgcaga       120
     ttatttggat tgagagtgaa tatgagactc taattggata ccgaggggaa                  170
//