An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-013; SV 0; linear; genomic DNA; STD; UNA; 90 BP.
XX
AC   ;
XX
DT   26-FEB-2016
DT   26-FEB-2016
XX
DE   Qualitative PCR method for detection of the junction between the maize ubiquitin promoter and the modified cry1Ab/1Ac genes (Grohmann et al.,2015).
XX
KW   construct_specific.
XX
OS   Oryza sativa (rice) - KeFeng6.
XX
RN   [1]
RP   1-90
RA   Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K.,
RA   Jit Randhawa G., Zur K.;
RT   "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products";
RL   Accred Qual Assur 20:85-96 (2015).
RX   DOI=10.1007/s00769-015-1108-5
XX
RN   [3]
RP   1-90
RT   "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR";
RL   BVL L 15.06-3:2013-08 (2013).
RX   BVL=bvl-l-1506-3/193413251
XX
RN   [3]
RP   1-90
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2015).
RX   PCR=QL-CON-00-013.pdf
XX
DR   GMOMETHODS; QL-TAX-OS-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..90
FT                   /standard_name="PCR 90 bp amplicon"
FT                   /note="Construct-specific RT-PCR"
FT                   /target="Junction region between the maize ubiquitin promoter (P-ubi) and the modified cry1Ab/1Ac genes"
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: Pubi-F2"
FT                   /note="ATTTGCTTGGTACTGTTTCTTTTGTC"
FT                   /target="P-ubi"
FT   primer_bind     34..60
FT                   /standard_name="RT-PCR probe: Pubi-T2"
FT                   /note="FAM-ACCCTGTTGTTTGGTGTTACTTCTGCA-NFQ"
FT   primer_bind     complement(66..90)
FT                   /standard_name="Primer reverse: Cry-rr-R"
FT                   /note="TTGTTGTCCATGGATCCTCTAGAGT"
FT                   /target="cry1Ab/Ac"
XX
SQ   Sequence 90 BP; 16 A; 19 C; 21 G; 34 T; 0 other;
     atttgcttgg tactgtttct tttgtcnnnn nnnaccctgt tgtttggtgt tacttctgca        60
     nnnnnactct agaggatcca tggacaacaa                                         90
//