European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ql-con-00-012'
ID   QL-CON-00-012; SV 1; linear; genomic DNA; STD; SYN; 220 BP.
XX
AC   CUH-CP551-8, CUH-CP631-7;
XX
DT   05-FEB-2014
DT   06-OCT-2016
XX
DE   Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chimeric CMV/PRSV coat protein (ISO/FDIS 21569:2005/Amd.1:2013).
XX
KW   construct_specific.
XX
OS   Carica papaya (papaya)
XX
RN   [1]
RP   1-220
RT   "Foodstuffs--Methods of analysis for the detection of genetically modified organisms and derived products -- Qualitative nucleic acid based methods Amendment 1";
RL   ISO 21569/Amd.1:1-87 (2013).
RX   ISO=56164
XX
RN   [2]
RP   1-220
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QL-CON-00-012.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..220
FT                   /standard_name="PCR 220 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chimeric cucumber mosaic virus coat protein/papaya ring spot virus coat protein (CMV/PRSV CP)"
FT   primer_bind     1..21
FT                   /standard_name="Primer reverse: sunup-ar1"
FT                   /note="TCATTCTTGGACTGACGACGT"
FT                   /target="CMV/PRSV CP"
FT   primer_bind     complement(173..198)
FT                   /standard_name="RT-PCR probe: 35S -T"
FT                   /note="FAM-CCCACTATCCTTCGCAAGACCCTTCC-TAMRA"
FT   primer_bind     complement(200..220)
FT                   /standard_name="Primer forward: 35S-F"
FT                   /note="GACGTAAGGGATGACGCACAA"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 220 BP; 62 A; 52 C; 48 G; 58 T; 0 other;
     tcattcttgg actgacgacg tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnggaagggt       180
     cttgcgaagg atagtgggnt tgtgcgtcat cccttacgtc                             220
//