An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ql-con-00-012'
ID   QL-CON-00-012; SV 1; linear; genomic DNA; STD; SYN; 220 BP.
XX
AC   CUH-CP551-8, CUH-CP631-7;
XX
DT   05-FEB-2014
DT   06-OCT-2016
XX
DE   Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chimeric CMV/PRSV coat protein (ISO/FDIS 21569:2005/Amd.1:2013).
XX
KW   construct_specific.
XX
OS   Carica papaya (papaya)
XX
RN   [1]
RP   1-220
RT   "Foodstuffs--Methods of analysis for the detection of genetically modified organisms and derived products -- Qualitative nucleic acid based methods Amendment 1";
RL   ISO 21569/Amd.1:1-87 (2013).
RX   ISO=56164
XX
RN   [2]
RP   1-220
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QL-CON-00-012.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..220
FT                   /standard_name="PCR 220 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chimeric cucumber mosaic virus coat protein/papaya ring spot virus coat protein (CMV/PRSV CP)"
FT   primer_bind     1..21
FT                   /standard_name="Primer reverse: sunup-ar1"
FT                   /note="TCATTCTTGGACTGACGACGT"
FT                   /target="CMV/PRSV CP"
FT   primer_bind     complement(173..198)
FT                   /standard_name="RT-PCR probe: 35S -T"
FT                   /note="FAM-CCCACTATCCTTCGCAAGACCCTTCC-TAMRA"
FT   primer_bind     complement(200..220)
FT                   /standard_name="Primer forward: 35S-F"
FT                   /note="GACGTAAGGGATGACGCACAA"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 220 BP; 62 A; 52 C; 48 G; 58 T; 0 other;
     tcattcttgg actgacgacg tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnggaagggt       180
     cttgcgaagg atagtgggnt tgtgcgtcat cccttacgtc                             220
//