European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ql-con-00-012'
Entry information
Entry name QL-CON-00-012;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier CUH-CP551-8, CUH-CP631-7
Description
Description Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chimeric CMV/PRSV coat protein (ISO/FDIS 21569:2005/Amd.1:2013).
Keywords construct_specific.
From Carica papaya (papaya)
References
1 "Foodstuffs--Methods of analysis for the detection of genetically modified organisms and derived products -- Qualitative nucleic acid based methods Amendment 1" ISO 21569/Amd.1:1-87 (2013)
ISO 56164
Reference Position 1-220
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QL-CON-00-012.pdf
Reference Position 1-220
Features
Key Location Qualifier Value
STS 1..220 standard_namePCR 220 bp amplicon
noteconstruct-specific RT-PCR
targetJunction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chimeric cucumber mosaic virus coat protein/papaya ring spot virus coat protein (CMV/PRSV CP)
primer_b 1..21 standard_namePrimer reverse: sunup-ar1
noteTCATTCTTGGACTGACGACGT
targetCMV/PRSV CP
primer_b complement(173..198) standard_nameRT-PCR probe: 35S -T
noteFAM-CCCACTATCCTTCGCAAGACCCTTCC-TAMRA
primer_b complement(200..220) standard_namePrimer forward: 35S-F
noteGACGTAAGGGATGACGCACAA
targetCaMV P-35S
Sequence information
Length: 220 BP, A Count: 62, C Count: 52, T Count: 58, G Count: 48
tcattcttgg actgacgacg tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnggaagggt       180
cttgcgaagg atagtgggnt tgtgcgtcat cccttacgtc                             220