An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-007; SV 0; linear; genomic DNA; STS; SYN; 83 BP.
XX
AC   ;
XX
DT   04-AUG-2009
DT   05-OCT-2016
XX
DE   Qualitative PCR method for detection of the junction  between a cry1A(b)/cry1A(c) fusion gene and DNA spacer sequences (Grohmann and Maede, 2009).
XX
KW   construct_specific.
XX
OS   Oryza sativa (rice) - event Bt63
XX
RN   [1]
RP   1-83
RA   Grohmann L., Maede D.;
RT   "Detection of genetically modified rice: collaborative validation study
RT   of a construct-specific real-time PCR method for detection of transgenic
RT   Bt rice";
RL   Eur. Food Res. Technol. 228:497-500 (2009).
RX   DOI=10.1007/s00217-008-0964-1
XX
RN   [2]
RP   1-83
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-CON-00-007.pdf
XX
DR   GMOMETHODS; QL-TAX-OS-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..83
FT                   /standard_name="PCR 83 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the cry1A(b)/cry1A(c) fusion gene and the DNA spacer sequences linking the fusion gene to the nopaline synthase terminator (T-nos)"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: T51F"
FT                   /note="GACTGCTGGAGTGATTATCGACAGA"
FT                   /target="cry1Ac"
FT   primer_bind     26..59
FT                   /standard_name="RT-PCR probe: T51p"
FT                   /note="FAM-TCGAGTTCATTCCAGTTACTGCAACACTCGAG-TAMRA"
FT   primer_bind     complement(60..83)
FT                   /standard_name="Primer reverse: T51R"
FT                   /note="AGCTCGGTACCTCGACTTATTCAG"
FT                   /target="DNA spacer sequences"
XX
SQ   Sequence 83 BP; 14 A; 9 C; 15 G; 11 T; 34 other;
     gactgctgga gtgattatcg acagannnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc        60
     tgaataagtc gaggtaccga gct                                                83
//