An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-ZM-014; SV 0; linear; genomic DNA; STS; PLN; 135 BP.
XX
AC   ;
XX
DT   29-MAY-2009
DT   18-JAN-2021
XX
DE   Quantitative PCR method for detection of maize alcoholdeydrogenase 1 gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Zea mays (maize)
XX
RN   [1]
RP   1-135
RA   Mazzara M.,  Munaro B., Foti N., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation Report and Protocol - Maize Seeds Sampling and DNA Extraction";
RL   Online Publication (2007).
RX   DOI=10.2788/30596
XX
RN   [2]
RP   1-135
RA   Charles Delobel C., Foti N., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43051
XX
RN   [3]
RP   1-135
RA   Charles Delobel C., Larcher S., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Event Bt11 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4370
XX
RN   [4]
RP   1-135
RA   Charles Delobel C., Larcher S., Savini C., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR - Validation Report and Protocol - Report on the Verification of Performance of a DNA Extraction Method for Maize Grains";
RL   Online Publication (2007).
RX   DOI=10.2788/62889
XX
RN   [5]
RP   1-135
RA   Charles Delobel C., Mazzara M., Bevilacqua A., Van den Eede G.;
RT   "Event-specific Method for the Quantification of Maize MIR162 by Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   DOI=10.2788/44161
XX
RN   [6]
RP   1-135
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "In-house Validation of an Event-specific Method for the Quantification of Maize Bt176 Using Real-time PCR - Validation Report";
RL   Online Publication (2011).
RX   EURL_GMFF=Bt176_CRLVL1804_VR.pdf
RX   EURL_GMFF=Bt176_CRLVL1804_validated_Method.pdf
XX
RN   [7]
RP   1-135
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2014).
RX   EURL_GMFF=EURL-VL-07-11VR_Maize 5307 final report.pdf
RX   EURL_GMFF=2014-12-05_VP_EURL-VL-07-11FINAL.pdf
XX
RN   [8]
RP   1-135
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MZHG0JG Using Real-time PCR - Validation Report";
RL   Online Publication (2018).
RX   EURL_GMFF=EURL-VL-04-16-VM.pdf
RX   EURL_GMFF=EURL-VL-04-16-VR.pdf
XX
RN   [9]
RP   1-135
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MZIR098 Using Real-time PCR - Validation Report";
RL   Online Publication (2018).
RX   EURL_GMFF=EURL-VL-04-17-VR.pdf
RX   EURL_GMFF=EURL-VL-04-17-VM.pdf
XX
RN   [10]
RP   1-135
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QT-EVE-ZM-013;
DR   GMOMETHODS; QT-EVE-ZM-019;
DR   GMOMETHODS; QT-EVE-ZM-015;
DR   GMOMETHODS; QT-EVE-ZM-014;
DR   GMOMETHODS; QT-EVE-ZM-022;
DR   GMOMETHODS; QT-EVE-ZM-023;
DR   GMOMETHODS; QT-EVE-ZM-002;
DR   GMOMETHODS; QT-EVE-ZM-027;
DR   GMOMETHODS; QT-EVE-ZM-028;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..135
FT                   /standard_name="PCR 135 bp amplicon"
FT                   /note="taxon-specific RT-PCR for maize"
FT                   /target="alcohol deydrogenase 1 (adh1) gene"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: Zm Adh1 primer F"
FT                   /note="CGTCGTTTCCCATCTCTTCCTCC"
FT                   /target="adh1"
FT   primer_bind     44..70
FT                   /standard_name="RT-PCR probe: Zm Adh1"
FT                   /note="VIC-AATCAGGGCTCATTTTCTCGCTCCTCA-TAMRA"
FT   primer_bind     complement(116..135)
FT                   /standard_name="Primer reverse: Zm Adh1 primer R"
FT                   /note="CCACTCCGAGACCCTCAGTC"
FT                   /target="adh1"
XX
SQ   Sequence 135 BP; 23 A; 36 C; 32 G; 44 T; 0 other;
     cgtcgtttcc catctcttcc tccnnnnnnn nnnnnnnnnn nnnaatcagg gctcattttc        60
     tcgctcctca nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnngactg       120
     agggtctcgg agtgg                                                        135
//