An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-ZM-011; SV 0; linear; genomic DNA; STS; PLN; 70 BP.
XX
AC   ;
XX
DT   03-JUL-2008
DT   27-JAN-2015
XX
DE   Quantitative PCR method for detection of maize alcohol dehydrogenase 1
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Zea mays
XX
RN   [1]
RP   1-70
RA   Paoletti C., Mazzara M., Puumalaainen J., Rasulo D., Van Den Eede G.;
RT   "Validation of an Event-Specific Method for the Quantitation of Maize Line GA21 Using Real-Time PCR Validation Report and Protocol";
RL   Online Publication (2005).
RX   CRL=GA21_Validation_Report+Protocol[1].pdf
XX
RN   [2]
RP   1-70
RA   Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2005).
RX   BSHOP=LBNA21830
XX
RN   [3]
RP   1-70
RA   Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2005).
RX   BSHOP=LBNA21825
XX
RN   [4]
RP   1-70
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QT-EVE-ZM-007;
DR   GMOMETHODS; QT-EVE-ZM-009;
DR   GMOMETHODS; QT-EVE-ZM-008;
XX
CC   Based on scientific evidence, the adh1 (70 bp) endogenous reference gene assay targets a
CC   region in the maize genome that shows a sequence polymorphism, which may affect the
CC   efficiency of amplification (Broothaerts et al., 2008). Users of this event-specific
CC   quantification method  should, therefore, replace the maize adh1 (70 bp) gene assay with
CC   the hmg gene assay (or any other suitable maize reference gene assay). Bridging
CC   experiments by the EURL-GMFF [EU-RL GMFF validation report (13 November 2013): Report on
CC   the verification of the performance of 1507, 59122, MON 810 and NK603 event-specific
CC   PCR-based methods applied to DNA extracted from stack maize 1507 x 59122 x MON 810 x NK603
CC   (http://biotech-staging.jrc.it/StatusOfDossiers.aspx)] have demonstrated that this
CC   event-specific quantification method performs adequately in combination with hmg as
CC   reference gene target.
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..70
FT                   /standard_name="PCR 70bp amplicon"
FT                   /note="taxon-specific RT-PCR for maize"
FT                   /target="alcohol dehydrogenase1 (adh1) gene"
FT   primer_bind     1..20
FT                   /standard_name="Primer reverse: Adh1 primer R"
FT                   /note="CCTTCTTGGCGGCTTATCTG"
FT                   /target="adh1"
FT   primer_bind     22..47
FT                   /standard_name="RT-PCR probe: Adh1 probe"
FT                   /note="FAM-CTTAGGGGCAGACTCCCGTGTTCCCT-TAMRA"
FT   primer_bind     complement(53..70)
FT                   /standard_name="Primer forward: Adh1 primer F"
FT                   /note="CCAGCCTCATGGCCAAAG"
FT                   /target="adh1"
XX
SQ   Sequence 70 BP; 6 A; 19 C; 19 G; 20 T; 6 other;
     ccttcttggc ggcttatctg ncttaggggc agactcccgt gttccctnnn nnctttggcc        60
     atgaggctgg                                                               70
//