European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


ID   QT-TAX-SL-002; SV 0; linear; genomic DNA; STS; PLN; 92 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   20-SEP-2010
XX
DE   Quantitative PCR method for detection of tomato LAT52
DE   (Yang et al., 2008).
XX
KW   taxon_specific, validated_independently.
XX
OS   Solanum lycopersicum (tomato)
XX
RN   [1]
RP   1-92
RA   Yang L., Zhang H., Guo J., Pan L., Zhang D.;
RT   "International Collaborative Study of the Endogenous Reference Gene LAT52
RT   Used for Qualitative and Quantitative Analyses of Genetically Modified
RT   Tomato";
RL   J. Agric. Food Chem. 56:3438-3443 (2008).
RX   DOI=10.1021/jf073464q
XX
RN   [2]
RP   1-92
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-TAX-SL-002.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..92
FT                   /standard_name="PCR 92 bp amplicon"
FT                   /note="Taxon-specific RT-PCR for tomato"
FT                   /target="LAT52 gene"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: Lat1"
FT                   /note="AGACCACGAGAACGATATTTGC"
FT                   /target="LAT52"
FT   primer_bind     complement(41..64)
FT                   /standard_name="RT-PCR probe: Lp"
FT                   /note="HEX-CTCTTTGCAGTCCTCCCTTGGGCT-BHQ"
FT   primer_bind     complement(69..92)
FT                   /standard_name="Primer reverse: Lat2"
FT                   /note="TTCTTGCCTTTTCATATCCAGACA"
FT                   /target="LAT52"
XX
SQ   Sequence 92 BP; 34 A; 13 C; 30 G; 15 T; 0 other;
     agaccacgag aacgatattt gcnnnnnnnn nnnnnnnnnn agcccaaggg aggactgcaa        60
     agagnnnntg tctggatatg aaaaggcaag aa                                      92
//