European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-SL-002;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of tomato LAT52 (Yang et al., 2008).
Keywords taxon_specific, validated_independently.
From Solanum lycopersicum (tomato)
References
1 Yang L., Zhang H., Guo J., Pan L., Zhang D.; "International Collaborative Study of the Endogenous Reference Gene LAT52 Used for Qualitative and Quantitative Analyses of Genetically Modified Tomato" J. Agric. Food Chem. 56:3438-3443 (2008)
DOI 10.1021/jf073464q
Reference Position 1-92
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-TAX-SL-002.pdf
Reference Position 1-92
Features
Key Location Qualifier Value
STS 1..92 standard_namePCR 92 bp amplicon
noteTaxon-specific RT-PCR for tomato
targetLAT52 gene
primer_b 1..22 standard_namePrimer forward: Lat1
noteAGACCACGAGAACGATATTTGC
targetLAT52
primer_b complement(41..64) standard_nameRT-PCR probe: Lp
noteHEX-CTCTTTGCAGTCCTCCCTTGGGCT-BHQ
primer_b complement(69..92) standard_namePrimer reverse: Lat2
noteTTCTTGCCTTTTCATATCCAGACA
targetLAT52
Sequence information
Length: 92 BP, A Count: 34, C Count: 13, T Count: 15, G Count: 30
agaccacgag aacgatattt gcnnnnnnnn nnnnnnnnnn agcccaaggg aggactgcaa        60
agagnnnntg tctggatatg aaaaggcaag aa                                      92