European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-OS-003;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of rice sucrose-phosphate synthase gene (Jiang et al., 2009).
Keywords taxon_specific, validated_independently.
From Oryza sativa (rice)
References
1 Jiang L., Yang L., Zhang H., Guo J., Mazzara M., Van den Eede G., Zhang D.; "International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice" J. Agric. Food Chem. 57:3525-3532 (2009)
PUBMED 19326953
DOI 10.1021/jf803166p
Reference Position 1-81
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-TAX-OS-003.pdf
Reference Position 1-81
Features
Key Location Qualifier Value
STS 1..81 standard_namePCR 81 bp amplicon
noteTaxon-specific RT-PCR for rice
targetsucrose-phosphate synthase (SPS) gene
primer_b 1..18 standard_namePrimer forward: SPS-1F
noteTTGCGCCTGAACGGATAT
targetSPS
primer_b complement(42..60) standard_nameRT-PCR probe: SPS-P
noteHEX-TCCGAGCCGTCCGTGCGTC-TAMRA
primer_b complement(62..81) standard_namePrimer reverse: SPS-3R
noteCGGTTGATCTTTTCGGGATG
targetSPS
Sequence information
Length: 81 BP, A Count: 21, C Count: 23, T Count: 17, G Count: 20
ttgcgcctga acggatatnn nnnnnnnnnn nnnnnnnnnn ngacgcacgg acggctcgga        60
ncatcccgaa aagatcaacc g                                                  81