An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-030; SV 0; linear; genomic DNA; STD; SYN; 116 BP.
XX
AC   MON-87429-9;
XX
DT   14-APR-2021
DT   27-AGO-2021
XX
DE   Quantitative PCR method for detection of maize event MON 87429 (EURL GMFF, 2021).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON 87429 (MON-87429-9)
XX
RN   [1]
RP   1-116
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validation Report";
RL   Online Publication (2021).
RX   EURL_GMFF=EURL-VL-07-19-VR.pdf
RX   EURL_GMFF=EURL-VL-07-19-VP.pdf
XX
RN   [2]
RP   1-116
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2021).
RX   PCR=QT-EVE-ZM-030.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..116
FT                   /standard_name="PCR 116 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event MON87429 and the maize host genome"                
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: MON 87429 primer 1"
FT                   /note="CGAGACAGACTCAATGTATCCGAGATACTC"
FT                   /target="5'-host genome"
FT   primer_bind     complement(56..85)
FT                   /standard_name="RT-PCR probe: MON 87429 probe"
FT                   /note="FAM-TCCCGGACATGAAACCAAACAAGAGTGGTC-TAMRA"
FT   primer_bind     complement(90..116)
FT                   /standard_name="Primer reverse: MON 87429 primer 2"
FT                   /note="CCATCATACTCATTGCTGATCCATGTA"
FT                   /target="insert"
XX
SQ   Sequence 116 BP; 33 A; 22 C; 26 G; 35 T; 0 other;
     cgagacagac tcaatgtatc cgagatactc nnnnnnnnnn nnnnnnnnnn nnnnngacca        60
     ctcttgtttg gtttcatgtc cgggannnnt acatggatca gcaatgagta tgatgg           116
//