European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-029;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87419-8
Description
Description Quantitative PCR method for detection of maize event MON87419 (EURL GMFF, 2019).
Keywords event_specific.
From Zea mays (maize) - event MON87419 (MON-87419-8)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR"; Online Publication (2019)
EURL_GMFF EURL-VL-02_17_VR_MON87419.pdf
EURL_GMFF EURL-VL-02_17_VM_MON87419.pdf
Reference Position 1-97
2 "PCR reactions set up and amplification conditions" Online Publication (2019)
PCR QT-EVE-ZM-029.pdf
Reference Position 1-97
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..97 standard_namePCR 97 bp amplicon
noteEvent-specific RT-PCR
(IBR) the insert of maize event MON87419 and the maize host genome";
primer_b 1..19 standard_namePrimer forward: 87419 QF
noteCGGTCGCTGCCAGGTATTG
target5'-host genome
primer_b 21..46 standard_nameRT-PCR probe: 87419 QP
noteFAM-TGTGCGCCAGTCAGCATCATCACACC-TAMRA
primer_b complement(75..97) standard_namePrimer reverse: 87419 QR
noteCAGACCTCAATTGCGAGCTTTCT
targetinsert
Sequence information
Length: 97 BP, A Count: 27, C Count: 22, T Count: 23, G Count: 25
cggtcgctgc caggtattgn tgtgcgccag tcagcatcat cacaccnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnagaaag ctcgcaattg aggtctg                                 97