ID QT-EVE-OS-002; SV 0; linear; genomic DNA; STS; SYN; 88 BP. XX AC ACS-OS002-5; XX DT 22-JAN-2007 DT 17-NOV-2010 XX DE Quantitative PCR method for detection of rice event LLRICE62 DE (Mazzara et al., 2006). XX KW event_specific. XX OS Oryza sativa (rice) - event LLRICE62 (ACS-OS002-5) XX RN [1] RP 1-88 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantitation of Rice Line LLRICE62 Using Real-time PCR -Validation Report and Protocol - Sampling and DNA Extraction of Rice"; RL Online Publication (2006). RX DOI=10.2788/31940 XX RN [2] RP 1-88 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-OS-002.pdf XX DR GMOMETHODS; QT-TAX-OS-017; XX FH Key Location/Qualifiers FH FT STS 1..88 FT /standard_name="PCR 88 bp_amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of rice event LLRICE62 and the rice host genome" FT primer_bind 1..22 FT /standard_name="Primer forward: MDB616" FT /note="AGCTGGCGTAATAGCGAAGAGG" FT /target="insert" FT primer_bind 25..54 FT /standard_name="RT-PCR probe: TM019" FT /note="FAM-CGCACCGATTATTTATACTTTTAGTCCACCT-TAMRA" FT primer_bind complement(68..88) FT /standard_name="Primer reverse: MDB694" FT /note="TGCTAACGGGTGCATCGTCTA" FT /target="3'-host genome" XX SQ Sequence 88 BP; 22 A; 20 C; 20 G; 26 T; 0 other; agctggcgta atagcgaaga ggcccgcacc gattatttat acttttagtc cacctggttt 60 ttattgatag acgatgcacc cgttagca 88 //