An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-GM-018; SV 0; linear; genomic DNA; STD; SYN; 84 BP.
XX
AC   BCS-GM151-6;
XX
DT   06-AGO-2020
DT   06-AGO-2020
XX
DE   Quantitative PCR method for detection of soybean event GMB151 (EURL GMFF, 2020).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event GMB151 (BCS-GM151-6)
XX
RN   [1]
RP   1-84
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Soybean GMB151 Using Real-time PCR - Validation Report";  
RL   Online Publication (2020).
RX   EURL_GMFF=EURL-VL-01-18-VR.pdf
RX   EURL_GMFF=EURL-VL-01-18-VM.pdf
XX
RN   [2]
RP   1-84
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2020).
RX   PCR=QT-EVE-GM-018.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..84
FT                   /standard_name="PCR 84 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event GMB151 and the soybean host genome"                
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: PRIM1040"
FT                   /note="TCAAATCAACATGGGTGACTAGAAA"
FT                   /target="5'-host genome"
FT   primer_bind     30..52
FT                   /standard_name="RT-PCR probe: TM1789"
FT                   /note="FAM-CAGTACTGGGCCCTTGTGGCGCT-BHQ1"
FT   primer_bind     complement(55..84)
FT                   /standard_name="Primer reverse: PRIM1041"
FT                   /note="CATTGTGCTGAATAGGTTTATAGCTATGAT"
FT                   /target="insert"
XX
SQ   Sequence 84 BP; 28 A; 19 C; 16 G; 21 T; 0 other;
     tcaaatcaac atgggtgact agaaannnnc agtactgggc ccttgtggcg ctnnatcata        60
     gctataaacc tattcagcac aatg                                               84
//