An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-EVE-GM-012; SV 0; linear; genomic DNA; STS; SYN; 91 BP.
AC   MON-87708-9;
DT   02-FEB-2011
DT   29-NOV-2013
DE   Quantitative PCR method for detection of soybean event MON87708 (Savini et al., 2013).
KW   event_specific.
OS   Glycine max (soybean) - event MON87708 (MON-87708-9)
RN   [1]
RP   1-91
RA   Savini C., Mazzara M., Munaro B., Kreysa J.;
RT   "Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   DOI=10.2788/90943
RN   [2]
RP   1-91
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QT-EVE-GM-012.pdf
FH   Key             Location/Qualifiers
FT   STS             1..91
FT                   /standard_name="PCR 91 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of soybean event MON87708 and the soybean host genome";
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: MON87708 primer 1"
FT                   /note="TCATACTCATTGCTGATCCATGTAG"
FT                   /target="insert"
FT   primer_bind     29..56
FT                   /standard_name="RT-PCR probe: MON87708 probe"
FT   primer_bind     complement(65..91)
FT                   /standard_name="Primer reverse: MON87708 primer 2"
FT                   /target="3'-host genome"
SQ   Sequence 91 BP; 19 A; 18 C; 14 G; 40 T; 0 other;
     tcatactcat tgctgatcca tgtagnnntc ccggacttta gctcaaaatg catgtannnn        60
     nnnncgttct gtcttttcgt taatttgttc t                                       91