An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-GH-013; SV 0; linear; genomic DNA; STD; SYN; 144 BP.
XX
AC   BCS-GH811-4;
XX
DT   04-AGO-2020
DT   04-AGO-2020
XX
DE   Quantitative PCR method for detection of cotton event GHB811 (EURL GMFF, 2020).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event GHB811 (BCS-GH811-4)
XX
RN   [1]
RP   1-144
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Cotton GHB811 Using Real-time PCR - Validation Report";   
RL   Online Publication (2020).
RX   EURL_GMFF=EURL-VL-04-18-VR_GHB811.pdf
RX   EURL_GMFF=EURL-VL-04-18-VP_GHB811.pdf
XX
RN   [2]
RP   1-144
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2020).
RX   PCR=QT-EVE-GH-013.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-020;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..144
FT                   /standard_name="PCR 144 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of cotton event GHB811 and the cotton host genome"                  
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: PRIM0638"
FT                   /note="CGAATAGTTCCATCAATTTTATCATTTATG"
FT                   /target="5'-host genome"
FT   primer_bind     38..55
FT                   /standard_name="RT-PCR probe: TM2207"
FT                   /note="FAM-AAGCCTTGAAACAGAACA-MGBNFQ"
FT   primer_bind     complement(123..144)
FT                   /standard_name="Primer reverse: PRIM1870"
FT                   /note="CGCTTTAACGTCCCTCAGATTT"
FT                   /target="insert"
XX
SQ   Sequence 144 BP; 40 A; 34 C; 35 G; 35 T; 0 other;
     cgaatagttc catcaatttt atcatttatg nnnnnnnaag ccttgaaaca gaacannnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnaaatctga gggacgttaa agcg                                              144
//