European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-009;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DP-073496-4
Description
Description Quantitative PCR method for detection of oilseed rape event 73496 (Jacchia et al., 2014).
Keywords event_specific.
From Brassica napus (oilseed rape) - event 73496 (DP-073496-4)
References
1 Jacchia S., Bogni A., Mazzara M., Kreysa J.; "Event-specific Method for the Quantification of Oilseed Rape DP-073496-4 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Oilseed Rape" Online Publication (2014)
EURL_GMFF EURL-VL-02-12VR-EFSA-Corr1.pdf
EURL_GMFF EURL-VL-02-12VP-EFSA-Corr1.pdf
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QT-EVE-BN-009.pdf
Reference Position 1-84
Cross-references
GMOMETHODS QT-TAX-BN-001;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of oilseed rape event 73496 and the oilseed rape host genome
primer_b 1..30 standard_namePrimer forward: 09-0-2824
noteGTTCTTCTCTTCATAGCTCATTACAGTTTT
target5'-host genome
primer_b 33..55 standard_nameRT-PCR probe: 09-QP-83
noteFAM-TTAGTTAGATCAGGATATTCTTG-MGBNFQ
primer_b complement(57..84) standard_namePrimer reverse: 09-0-2825
noteCAAACCTCCATAGAGTTCAACATCTTAA
targetinsert
Sequence information
Length: 84 BP, A Count: 19, C Count: 12, T Count: 37, G Count: 16
gttcttctct tcatagctca ttacagtttt nnttagttag atcaggatat tcttgnttaa        60
gatgttgaac tctatggagg tttg                                               84